AGAP1 (NM_001244888) Human Untagged Clone

CAT#: SC332101

AGAP1 (untagged) - Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 (AGAP1), transcript variant 3



  "NM_001244888" in other vectors (2)

CNY 3,900.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
AGAP1 mouse monoclonal antibody, clone OTI4E8 (formerly 4E8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGAP-1; CENTG2; cnt-g2; GGAP1
Vector pCMV6-Entry
Sequence Data
>SC332101 representing NM_001244888.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACTACCAGCAGCAGCTGGCCAACTCGGCTGCCATCCGGGCCGAGATCCAGCGCTTCGAGTCGGTC
CACCCCAACATCTACTCCATCTACGAGCTGCTGGAGCGCGTGGAGGAGCCGGTGCTGCAGAACCAGATC
CGGGAGCACGTCATCGCCATCGAAGATGCCTTCGTGAACAGCCAGGAATGGACGCTGAGTCGATCTGTC
CCGGAGCTCAAAGTGGGAATTGTGGGTAACTTGGCCAGCGGCAAGTCTGCCCTGGTGCACCGGTACCTG
ACGGGCACATATGTCCAGGAGGAGTCTCCGGAAGGTGGCAGGTTCAAGAAAGAGATTGTCGTTGATGGA
CAGAGCTATCTGCTGCTGATCAGAGATGAAGGGGGCCCCCCGGAGGCGCAGTTTGCCATGTGGGTGGAC
GCTGTTATATTTGTCTTCAGCTTGGAGGATGAAATAAGTTTCCAGACCGTTTACCACTACTACAGTCGA
ATGGCCAACTATCGGAACACGAGCGAGATTCCTCTGGTTCTGGTGGGAACCCAGGATGCCATAAGTTCT
GCTAACCCGAGGGTCATCGATGACGCCAGGGCGAGGAAGCTCTCCAACGACCTGAAACGGTGCACGTAC
TACGAGACGTGTGCTACATACGGGCTGAATGTGGAGAGGGTCTTCCAGGACGTTGCCCAGAAGATTGTT
GCCACAAGGAAGAAGCAGCAGCTGTCCATAGGACCCTGCAAGTCGCTACCTAATTCTCCCAGCCATTCC
TCCGTCTGTTCCGCGCAGGTGTCTGCCGTGCACATCAGCCAGACAAGTAATGGAGGTGGGAGTTTAAGC
GACTATTCCTCCTCCGTTCCATCGACTCCCAGCACCAGCCAGAAGGAACTTCGGATCGATGTTCCTCCC
ACTGCCAACACGCCCACGCCCGTTCGCAAGCAGTCTAAGCGCCGGTCCAACCTGTTCACCTCTCGGAAA
GGGAGCGACCCAGACAAAGAGAAGAAAGGCCTGGAGAGTCGTGCGGACAGCATTGGGAGCGGCCGAGCC
ATCCCAATTAAACAGGGCCTGCCCTTCTTTGTCCTTGCACTGACAGCCAGCACTTATCTCAGGCCTGCT
GGAGCCCGTGCCCGTCAGTCCTCCCCCTGGCCAGGGCCGAGGGGTGGTCAGACCAGCCCGCATTGTGCT
GAAGGCCCACAATCAGCCCAGCTGTCCGGGGCCATGATGAATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001244888
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244888.1
RefSeq Size 2180 bp
RefSeq ORF 1218 bp
Locus ID 116987
UniProt ID Q9UPQ3
Protein Pathways Endocytosis
MW 44.5 kDa
Gene Summary This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) lacks several exons and includes an alternate 3' terminal exon compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...