SRP19 (NM_001204194) Human Untagged Clone

CAT#: SC331526

SRP19 (untagged) - Homo sapiens signal recognition particle 19kDa (SRP19), transcript variant 3



  "NM_001204194" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SRP19 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331526 representing NM_001204194.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTTGCGCTGCCGCGCGGTCCCCGGCCGACCAGGACAGGTTTATTTGTATCTATCCTGCTTATTTA
AATAATAAGAAGACCATCGCAGAGGGAAGGCGAATCCCCATAAGTAAGAAAAATAAAATGTACTCTAGA
GAATGGAATCGTGATGTCCAATACAGAGGCAGAGTCCGGGTCCAGCTCAAACAGGAAGATGGGAGCCTC
TGCCTTGTACAGTTCCCATCACGTAAGTCAGTAATGTTGTATGCAGCAGAAATGATACCTAAACTAAAA
ACAAGGACACAAAAAACAGGAGGTGCTGACCAAAGTCTTCAACAAGGAGAGGGAAGTAAAAAAGGGAAA
GGAAAGAAAAAGAAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204194
Insert Size 363 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204194.1
RefSeq Size 1430 bp
RefSeq ORF 363 bp
Locus ID 6728
UniProt ID P09132
Protein Pathways Protein export
MW 13.7 kDa
Gene Summary Signal-recognition-particle assembly, binds directly to 7S RNA and mediates binding of the 54 kDa subunit of the SRP.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...