GTF2H3 (NM_001271867) Human Untagged Clone

CAT#: SC330987

GTF2H3 (untagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 3



  "NM_001271867" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GTF2H3 mouse monoclonal antibody,clone OTI4B5
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BTF2; P34; TFB4; TFIIH
Vector pCMV6-Entry
Sequence Data
>SC330987 representing NM_001271867.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCTGGGAAATTCGCATTTATTCATGAATCGTTCCAACAAACTTGCTGTGATAGCAAGTCACATT
CAAGAAAGCCGATTCTTATATCCTGGAAAGAATGGCAGACTTGGAGACTTCTTCGGAGACCCTGGCAAC
CCTCCTGAATTTAATCCCTCTGGGAGTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGAAGTT
ATTGTTGAAGAGATTAAAGATCTAATGACCAAAAGTGACATAAAGGGTCAACATACAGAAACTTTGCTG
GCAGGATCCCTGGCCAAAGCCCTTTGCTACATTCATAGAATGAACAAGGAAGTTAAAGACAATCAGGAA
ATGAAATCAAGGATATTGGTGATTAAGGCTGCAGAAGACAGTGCGTTGCAGTATATGAACTTCATGAAT
GTCATCTTTGCAGCACAGAAACAGAATATTTTGATTGATGCCTGTGTTTTAGACTCCGACTCAGGGCTC
CTCCAACAGGCTTGTGACATCACGGGAGGACTGTACCTGAAGGTGCCTCAGATGCCTTCTCTTCTGCAG
TATTTGCTGTGGGTGTTTCTTCCCGATCAAGATCAGAGATCTCAGTTAATCCTCCCACCCCCAGTTCAT
GTTGACTACAGGGCTGCTTGCTTCTGTCATCGAAATCTCATTGAAATTGGTTATGTCTGTTCTGTGTGT
TTGTCAATATTCTGCAATTTCAGCCCCATTTGTACTACGTGCGAGACAGCCTTTAAAATTTCTCTGCCT
CCAGTGCTGAAAGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271867
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271867.1
RefSeq Size 3354 bp
RefSeq ORF 804 bp
Locus ID 2967
UniProt ID Q13889
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Basal transcription factors, Nucleotide excision repair
MW 29.8 kDa
Gene Summary This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (3) lacks an exon in the central coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) has a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...