PLA2G2D (NM_001271814) Human Untagged Clone

CAT#: SC330972

PLA2G2D (untagged) - Homo sapiens phospholipase A2, group IID (PLA2G2D), transcript variant 2



  "NM_001271814" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PLA2G2D Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PLA2IID; sPLA2-IID; sPLA2S; SPLASH
Vector pCMV6-Entry
Sequence Data
>SC330972 representing NM_001271814.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAACTTGCACTGCTGTGTGGGCTGGTGGTGATGGCTGGTGTGATTCCAATCCAGGGCGGGATCCTG
AACCTGAACAAGATGGTCAAGCAAGTGACTGGGAAAATGCCCATCCTCTCCTACTGGCCCTACGGCTGT
CACTGCGGACTAGGTGGCAGAGGCCAACCCAAAGATGCCACGGACTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271814
Insert Size 189 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271814.1
RefSeq Size 1878 bp
RefSeq ORF 189 bp
Locus ID 26279
UniProt ID Q9UNK4
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
MW 6.6 kDa
Gene Summary This gene encodes a secreted member of the phospholipase A2 family, and is found in a cluster of related family members on chromosome 1. Phospholipase A2 family members hydrolyze the sn-2 fatty acid ester bond of glycerophospholipids to produce lysophospholipids and free fatty acid. This gene may be involved in inflammation and immune response, and in weight loss associated with chronic obstructive pulmonary disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks an internal exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...