UBE2V1 (NM_001257396) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CIR1; CROC-1; CROC1; UBE2V; UEV-1; UEV1; UEV1A
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330615 representing NM_001257396. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAGCCACCACGGGCTCGGGAGTAAAAGTCCCTCGCAATTTCCGACTGTTGGAAGAACTCGAAGAA GGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTAGAAGATGACGAAGACATGACACTTACA AGATGGACAGGGATGATAATTGGGCCTCCAAGAGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGG CAGAATTCATATAGCATCAAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATG AAACTCCCTCAGCCGCCCGAAGGACAGTGTTACAGCAATTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001257396
Insert Size	318 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001257396.1
RefSeq Size	2032 bp
RefSeq ORF	318 bp
Locus ID	7335
UniProt ID	Q13404
Protein Families	Druggable Genome, Transcription Factors
MW	11.8 kDa
Gene Summary	Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (8) differs in the 5' UTR, initiates translation at an alternate start codon and lacks an exon in the 3' coding region, compared to variant 1. The encoded isoform (f) is shorter and has a distinct N-terminus, compared to isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.