CHRNB4 (NM_001256567) Human Untagged Clone

CAT#: SC330456

CHRNB4 (untagged) - Homo sapiens cholinergic receptor, nicotinic, beta 4 (neuronal) (CHRNB4), transcript variant 2



  "NM_001256567" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330456 representing NM_001256567.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCGCGCGCCTTCCCTGGTCCTTTTCTTCCTGGTCGCCCTTTGCGGGCGCGGGAACTGCCGCGTG
GCCAATGCGGAGGAAAAGCTGATGGACGACCTTCTGAACAAAACCCGTTACAATAACCTGATCCGCCCA
GCCACCAGCTCCTCACAGCTCATCTCCATCAAGCTGCAGCTCTCCCTGGCCCAGCTTATCAGCGTGAAT
GAGCGAGAGCAGATCATGACCACCAATGTCTGGCTGAAACAGGAATGGACTGATTACCGCCTGACCTGG
AACAGCTCCCGCTACGAGGGTGTGAACATCCTGAGGATCCCTGCAAAGCGCATCTGGTTGCCTGACATC
GTGCTTTACAACAAGTCGTTGAGGACTGGAAGTACGTGGCTATGGTGGTGGACCGGCTGTTCCTGTGGG
TGTTCATGTTTGTGTGCGTCCTGGGCACTGTGGGGCTCTTCCTACCGCCCCTCTTCCAGACCCATGCAG
CTTCTGAGGGGCCCTACGCTGCCCAGCGTGACTGAGGGCCCCCTGGGTTGTGGGGTGAGAGGATGTGAG
TGGCCGGGTGGGCACTTTGCTGCTTCTTTCTGGGTTGTGGCTGATGAGGCCCTAAGTAAATATGTGAGC
ATTGGCCATCAACCCCATCAAACCAGCCACAGCCGTGGAACAGGCAAGGATGGGGGCCTGGGCTGTCCT
CTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256567
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256567.1
RefSeq Size 1469 bp
RefSeq ORF 696 bp
Locus ID 1143
UniProt ID P30926
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
MW 25.9 kDa
Gene Summary This gene is found within a conserved gene cluster and encodes one of the beta subunits of the nicotinic acetylcholine receptor (nAChRs) superfamily which form ligand-gated ion channels with a central pore that forms a cation channel. Neuronal nAChRs are pentameric structures that can be either homomeric or heteromeric, with heteromeric structures containing both alpha and beta subunits. Each subunit contains an extracellular amino terminus and four transmembrane domains. Nicotine is one of the agonists that binds to the receptor. Variants in this gene have been associated with nicotine dependence and lung cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2017]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2) with a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...