UBE2L3 (NM_001256355) Human Untagged Clone

CAT#: SC330399

UBE2L3 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2L 3 (UBE2L3), transcript variant 4



  "NM_001256355" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to UBE2L3 (ubiquitin-conjugating enzyme E2L 3)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E2-F1; L-UBC; UBCH7; UbcM4
Vector pCMV6-Entry
Sequence Data
>SC330399 representing NM_001256355.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGGTCGCTGCAGGGACCCGAGGCGACACGCGCCTGCAGGAGGTGGCACTCCTGCCGCAGCTCTTC
GATCTGCTTGTCCTTGGCCAGCGGCGCGCTCGCCTGCTCCGACAGGTCCCGAGCGCGCTGGCGGGCAAA
GACTTGGCACAGCTCCAGGCCGGCGCAACTCTCGCCGGGTATAGGCGCGCTCACGGCCCGGAGGAGCTT
GAAGAAATCCGCAAATGTGGGATGAAAAACTTCCGTAACATCCAGGTTGATGAAGCTAATTTATTGACT
TGGCAAGGGCTTATTGTTCCTGACAACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTT
CCAGCAGAGTACCCATTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGAC
GAAAAGGGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAACCGACCAA
GTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCTTCGGGCTGACCTAGCT
GAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAGTTTACAAAGAAATATGGGGAA
AAGCGACCTGTGGACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256355
Insert Size 639 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256355.1
RefSeq Size 3007 bp
RefSeq ORF 639 bp
Locus ID 7332
UniProt ID P68036
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
MW 24 kDa
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is demonstrated to participate in the ubiquitination of p53, c-Fos, and the NF-kB precursor p105 in vitro. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (4) encodes the longest isoform (4).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...