RAB5B (NM_001252037) Human Untagged Clone

CAT#: SC330266

RAB5B (untagged) - Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 3



  "NM_001252037" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RAB5B Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330266 representing NM_001252037.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTAGCAGAAGCACAGCTAGGCCCAATGGGCAACCCCAGGCCAGCAAAATTTGCCAGTTCAAATTG
GTCCTGCTGGGAGAATCTGCAGTGGGAAAGTCAAGCCTGGTATTACGTTTTGTCAAAGGGCAGTTCCAT
GAGTACCAGGAGAGCACCATTGGAGCGGCCTTCCTCACCCAGTCCGTTTGTCTAGATGACACAACAGTG
AAGTTTGAGATCTGGGACACAGCTGGGCAGGAGCGATATCACAGCTTAGCCCCCATGTACTACAGGGGT
GCCCAAGCTGCAATCGTGGTTTACGACATTACTAATCAGGAGGCCCAGGCATATGCAGATGACAACAGC
TTATTGTTCATGGAGACTTCAGCCAAGACAGCTATGAACGTGAATGATCTCTTCCTGGCAATAGCTAAG
AAGTTGCCAAAGAGTGAACCCCAGAATCTGGGAGGTGCAGCAGGCCGAAGCCGGGGTGTGGATCTCCAT
GAACAGTCCCAGCAGAACAAGAGCCAGTGTTGTAGCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001252037
Insert Size 525 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252037.1
RefSeq Size 5217 bp
RefSeq ORF 525 bp
Locus ID 5869
UniProt ID P61020
Protein Families Druggable Genome
Protein Pathways Endocytosis
MW 19.1 kDa
Gene Summary Protein transport. Probably involved in vesicular traffic (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. the encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...