CHMP2B (NM_001244644) Human Untagged Clone

CAT#: SC330215

CHMP2B (untagged) - Homo sapiens charged multivesicular body protein 2B (CHMP2B), transcript variant 2



  "NM_001244644" in other vectors (2)

CNY 2,640.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CHMP2B rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALS17; CHMP2.5; DMT1; FTDALS7; VPS2-2; VPS2B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC330215 representing NM_001244644.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAATTAGAAATTAAGAAAATGGCCAAGATTGGTAATAAGGAAGCTTGCAAAGTTTTAGCCAAACAA
CTTGTGCATCTACGGAAACAGAAGACGAGAACTTTTGCTGTAAGTTCAAAAGTTACTTCTATGTCTACA
CAAACAAAAGTGATGAATTCCCAAATGAAGATGGCTGGAGCAATGTCTACTACAGCAAAAACAATGCAG
GCAGTTAACAAGAAGATGGATCCACAAAAGACATTACAAACAATGCAGAATTTCCAGAAGGAAAACATG
AAAATGGAAATGACTGAAGAAATGATCAATGATACACTTGATGACATCTTTGACGGTTCTGATGACGAA
GAAGAAAGCCAGGATATTGTGAATCAAGTTCTTGATGAAATTGGAATTGAAATTTCTGGAAAGATGGCC
AAAGCTCCATCAGCTGCTCGAAGCTTACCATCTGCCTCTACTTCAAAGGCTACAATCTCAGATGAAGAG
ATTGAACGGCAACTCAAGGCTTTAGGAGTAGATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001244644
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244644.1
RefSeq Size 2551 bp
RefSeq ORF 519 bp
Locus ID 25978
UniProt ID Q9UQN3
Protein Pathways Endocytosis
MW 19.1 kDa
Gene Summary This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region, compared to variant 1. The resulting predicted protein (isoform 2) is shorter when it is compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...