UGT2B28 (NM_001207004) Human Untagged Clone

CAT#: SC329882

UGT2B28 (untagged) - Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide B28 (UGT2B28), transcript variant 2



  "NM_001207004" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC329882 representing NM_001207004.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCTGAAGTGGACTTCAGTTCTTCTGCTGATACATCTCGGTTGTTACTTTAGCTCTGGGAGTTGT
GGAAAGGTGCTGGTGTGGACCGGTGAATACAGCCATTGGATGAATATGAAGACAATCCTGAAAGAGCTT
GTTCAGAGAGGTCATGAGGTGACTGTACTGGCATCTTCAGCTTCCATTCTTTTTGATCCCAATGACGCA
TTCACTCTTAAACTCGAAGTTTATCCTACATCTTTAACTAAAACTGAATTTGAGAATATCATCATGCAA
CAGGTTAAGAGATGGTCAGACATTCAAAAAGATAGCTTTTGGTTATATTTTTCACAAGAACAAGAAATC
CTGTGGGAATTTCATGACATATTTAGAAACTTCTGTAAAGATGTAGTTTCAAATAAGAAAGTTATGAAA
AAACTACAAGAGTCAAGATTTGACATCATTTTTGCAGATGCTTTTTTTCCTTGTGGTGAGCTGCTGGCT
GCGCTACTTAACATACCGTTTGTGTACAGTCTCTGCTTCACTCCTGGCTACACAATTGAAAGGCACAGT
GGAGGACTGATTTTCCCTCCTTCCTACATACCTGTTGTTATGTCAAAATTAAGTGATCAAATGACTTTC
ATGGAGAGGGTAAAAAACATGATCTATGTGCTTTATTTTGACTTTTGGTTCCAAATGTGTGATATGAAG
AAGTGGGATCAGTTTTACAGTGAAGTTTTAGGAAGACCCACTACCTTATTTGAGACAATGGGGAAAGCT
GACATATGGCTTATGCGAAACTCCTGGAGTTTTCAATTTCCTCATCCATTCTTACCAAACATTGATTTT
GTTGGAGGACTCCACTGCAAACCTGCCAAACCCCTACCTAAGGAAATGGAGGAATTTGTACAGAGCTCT
GGTGAAAATGGTGTTGTGGTGTTTTCTCTGGGGTCAGTGATAAGTAACATGACAGCAGAAAGGGCCAAC
GTAATTGCAACAGCCCTTGCCAAGATCCCACAAAAGATATAA

Restriction Sites SgfI-MluI     
ACCN NM_001207004
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001207004.1
RefSeq Size 1543 bp
RefSeq ORF 1008 bp
Locus ID 54490
UniProt ID Q9BY64
Protein Families Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
MW 38.7 kDa
Gene Summary This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Two transcript variants encoding different isoforms have been found for this gene. While both isoforms are targeted to the endoplasmic reticulum, only the longer isoform appears to be active. [provided by RefSeq, May 2011]
Transcript Variant: This variant (2) lacks two coding exons compared to variant 1, that causes a frameshift.The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...