Bile Acid Receptor (NR1H4) (NM_001206992) Human Untagged Clone

CAT#: SC329876

NR1H4 (untagged) - Homo sapiens nuclear receptor subfamily 1, group H, member 4 (NR1H4), transcript variant 4



  "NM_001206992" in other vectors (2)

CNY 5,856.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
NR1H4 mouse monoclonal antibody,clone OTI4F12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAR; FXR; HRR-1; HRR1; PFIC5; RIP14
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001206992, the custom clone sequence may differ by one or more nucleotides


ATGGTAATGCAGTTTCAGGGGTTAGAAAATCCAATTCAAATTAGTCCTCACTGCAGCTGTACGCCGTCAG
GATTTTTCATGGAAATGATGAGTATGAAGCCCGCGAAAGGTGTTTTAACAGAACAAGTGGCAGGTCCTCT
GGGACAGAACCTGGAAGTGGAACCATACTCGCAATACAGCAATGTTCAGTTTCCCCAAGTTCAACCACAG
ATTTCCTCGTCATCCTATTATTCCAACCTGGGTTTCTACCCCCAGCAGCCTGAAGAGTGGTACTCTCCTG
GAATATATGAACTCAGGCGTATGCCAGCTGAGACTCTCTACCAGGGAGAAACTGAGGTAGCAGAGATGCC
TGTAACAAAGAAGCCCCGCATGGGCGCGTCAGCAGGGAGGATCAAAGGGGATGAGCTGTGTGTTGTTTGT
GGAGACAGAGCCTCTGGATACCACTATAATGCACTGACCTGTGAGGGGTGTAAAGGTTTCTTCAGGAGAA
GCATTACCAAAAACGCTGTGTACAAGTGTAAAAACGGGGGCAACTGTGTGATGGATATGTACATGCGAAG
AAAGTGTCAAGAGTGTCGACTAAGGAAATGCAAAGAGATGGGAATGTTGGCTGAATGCTTGTTAACTGAA
ATTCAGTGTAAATCTAAGCGACTGAGAAAAAATGTGAAGCAGCATGCAGATCAGACCGTGAATGAAGACA
GTGAAGGTCGTGACTTGCGACAAGTGACCTCGACAACAAAGTCATGCAGGGAGAAAACTGAACTCACCCC
AGATCAACAGACTCTTCTACATTTTATTATGGATTCATATAACAAACAGAGGATGCCTCAGGAAATAACA
AATAAAATTTTAAAAGAAGAATTCAGTGCAGAAGAAAATTTTCTCATTTTGACGGAAATGGCAACCAATC
ATGTACAGGTTCTTGTAGAATTCACAAAAAAGCTACCAGGATTTCAGACTTTGGACCATGAAGACCAGAT
TGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTT
CCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACAC
CTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGC
AATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCA
CTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCC
TGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCTGAGATGCTGATGTCATGGAGAGTAAA
CGACCACAAGTTTACCCCACTTCTCTGTGAAATCTGGGACGTGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001206992
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206992.1, NP_001193921.1
RefSeq Size 1895 bp
RefSeq ORF 1449 bp
Locus ID 9971
UniProt ID Q96RI1
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Gene Summary This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (4) differs 5' UTR, lacks a portion of the 5' coding region, and uses an alternate in-frame splice site, compared to variant 1. It represents use of an alternate promoter and initiates translation at an alternate start codon. The encoded isoform (4, also known as FXRbeta-) has a distinct N-terminus and is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...