PSMC2 (NM_001204453) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	MSS1; Nbla10058; RPT1; S7
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329755 representing NM_001204453. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCGGATTACCTCGGTGCCGATCAGCGGAAGACCAAAGAGGATGAGAAGGACGACAAGCCCATCCGA GCTCTGGATGAGGGGGATATTGCCTTGTTGAAAACTTATGGTCAGAGCACTTACTCTAGGCAGATCAAG CAAGTTGAAGATGACATTCAGCAACTTCTCAAGAAAATTAATGAGCTCACTGGTATTAAAGAATCTGAC ACTGGCCTGGCCCCACCAGCACTCTGGGATTTGGCTGCAGATAAGCAGACACTCCAGAGTGAACAGCCT TTACAGGTTGCCAGGTGTACAAAGATAATCAATGCTGATTCGGAGGACCCAAAATACATTATCAACGTA AAGCAGTTTGCCAAGTTTGTGGTGGACCTTAGTGATCAGGTGGCACCTACTGACATTGAAGAAGGGATG AGAGTGGGGTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001204453
Insert Size	426 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001204453.1
RefSeq Size	989 bp
RefSeq ORF	426 bp
Locus ID	5701
UniProt ID	P35998
Protein Pathways	Proteasome
MW	15.8 kDa
Gene Summary	The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit has been shown to interact with several of the basal transcription factors so, in addition to participation in proteasome functions, this subunit may participate in the regulation of transcription. This subunit may also compete with PSMC3 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) includes an alternate segment at its 3' terminal exon which contains a premature stop codon, compared to variant 1. This variant encodes an isoform (2) with a shorter C-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.