DNAL1 (NM_001201366) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	C14orf168; CILD16; LC1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329617 representing NM_001201366. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATGCATCCTTGTCCATGCTTGCTAATTGCGAGAAGCTTTCACTGTCTACAAACTGCATTGAAAAA ATTGCCAACCTGAATGGCTTAAAAAACTTGAGGATATTATCTTTAGGAAGAAACAACATAAAGAACTTA AATGGACTGGAGGCAGTAGGGGACACATTAGAAGAACTGTGGATCTCCTACAATTTTATTGAGAAGTTG AAAGGGATCCACATAATGAAGAAATTGAAGATTCTCTACATGTCTAATAACCTGGTAAAAGACTGGGCT GAGTTTGTGAAGCTGGCAGAACTGCCATGCCTCGAAGACCTGGTGTTTGTAGGCAATCCCTTGGAAGAG AAACATTCTGCTGAGAATAACTGGATTGAAGAAGCAACCAAGAGAGTGCCCAAACTGAAAAAGCTGGAT GGTACTCCAGTAATTAAAGGGGATGAGGAAGAAGACAACTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001201366
Insert Size	456 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001201366.1
RefSeq Size	8584 bp
RefSeq ORF	456 bp
Locus ID	83544
UniProt ID	Q4LDG9
Protein Pathways	Huntington's disease
MW	17.1 kDa
Gene Summary	This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.