NDUFB5 (NM_001199957) Human Untagged Clone

CAT#: SC329601

NDUFB5 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), transcript variant 2



  "NM_001199957" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to NDUFB5 (NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CISGDH; SGDH
Vector pCMV6-Entry
Sequence Data
>SC329601 representing NM_001199957.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGCGGTGGCAGCTCTGTCTGGCCGGCCCCTT
GGCACTCGCCTCGGATTTGGGGGCTTCCTCACTCGTGGCTTTCCGAAGGCTGCTGGTCAAGCTGAACTA
GCAGAAATTCCAGAAGGCTATGTCCCAGAACACTGGGAATATTATAAGCATCCCATATCAAGATGGATT
GCCCGTAATTTCTATGATAGTCCTGAAAAGATATATGAAAGAACAATGGCCGTCCTTCAGATTGAAGCT
GAAAAGGCTGAATTACGGGTAAAGGAGCTGGAAGTGCGAAAATTGATGCATGTGAGAGGAGATGGACCC
TGGTATTACTATGAGACAATTGACAAGGAACTTATTGATCATTCTCCGAAAGCAACTCCTGACAATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199957
Insert Size 414 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199957.1
RefSeq Size 920 bp
RefSeq ORF 414 bp
Locus ID 4711
UniProt ID O43674
Protein Families Transmembrane
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 15.7 kDa
Gene Summary The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...