SESN1 (NM_001199934) Human Untagged Clone

CAT#: SC329596

SESN1 (untagged) - Homo sapiens sestrin 1 (SESN1), transcript variant 3



  "NM_001199934" in other vectors (2)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-SESN1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PA26; SEST1
Vector pCMV6-Entry
Sequence Data
>SC329596 representing NM_001199934.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCATGCTTTATTTGCAGATTCTTTTGCTGCTTTGGGCCGTTTGGATAACATTACGTTAGTGATGGTT
TTCCACCCACAATATTTAGAAAGTTTCTTAAAAACTCAGCACTATCTACTGCAAATGGATGGGCCGTTA
CCCCTACATTATCGTCACTACATTGGAATAATGGCTGCGGCAAGACATCAGTGCTCCTACTTAGTGAAC
CTGCATGTAAATGATTTCCTTCATGTTGGTGGGGACCCCAAGTGGCTCAATGGTTTAGAGAATGCTCCT
CAAAAACTACAGAATTTAGGAGAACTTAACAAAGTGTTAGCCCATAGACCTTGGCTTATTACCAAAGAA
CACATTGAGGGACTTTTAAAAGCTGAAGAGCACAGCTGGTCCCTTGCGGAATTGGTACATGCAGTAGTT
TTACTCACACACTATCATTCTCTTGCCTCATTCACATTCGGCTGTGGAATCAGTCCAGAAATTCATTGT
GATGGTGGCCACACATTCAGACCTCCTTCTGTTAGCAACTACTGCATCTGTGACATTACAAATGGCAAT
CACAGTGTGGATGAGATGCCGGTCAACTCAGCAGAAAATGTTTCTGTAAGTGATTCTTTCTTTGAGGTT
GAAGCCCTCATGGAAAAGATGAGGCAGTTACAGGAATGTCGAGATGAAGAAGAGGCAAGTCAGGAAGAG
ATGGCTTCACGTTTTGAAATAGAAAAAAGAGAGAGTATGTTTGTCTTCTCTTCAGATGATGAAGAAGTT
ACACCAGCAAGAGCTGTATCTCGTCATTTTGAGGATACTAGTTATGGCTATAAAGATTTCTCTAGACAT
GGGATGCATGTTCCAACATTTCGTGTCCAGGACTATTGCTGGGAAGATCATGGTTATTCTTTGGTAAAT
CGCCTTTATCCAGATGTGGGACAGTTGATTGATGAAAAATTTCACATTGCTTACAATCTTACTTATAAT
ACAATGGCAATGCACAAAGATGTTGATACCTCAATGCTTAGACGGGCAATTTGGAACTATATTCACTGC
ATGTTTGGAATAAGATATGATGATTATGACTATGGTGAAATTAACCAGCTATTGGATCGTAGCTTTAAA
GTTTATATCAAAACTGTTGTTTGCACTCCTGAAAAGGTTACCAAAAGAATGTATGATAGCTTCTGGAGG
CAGTTCAAGCACTCTGAGAAGGTTCATGTTAATCTGCTTCTTATAGAAGCTAGGATGCAAGCAGAACTC
CTTTATGCTCTGAGAGCCATTACCCGCTATATGACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199934
Insert Size 1281 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199934.1
RefSeq Size 2740 bp
RefSeq ORF 1281 bp
Locus ID 27244
UniProt ID Q9Y6P5
Protein Pathways p53 signaling pathway
MW 49.6 kDa
Gene Summary This gene encodes a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The encoded protein mediates p53 inhibition of cell growth by activating AMP-activated protein kinase, which results in the inhibition of the mammalian target of rapamycin protein. The encoded protein also plays a critical role in antioxidant defense by regenerating overoxidized peroxiredoxins, and the expression of this gene is a potential marker for exposure to radiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...