MTHFS (NM_001199758) Human Untagged Clone
CAT#: SC329557
MTHFS (untagged) - Homo sapiens 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HsT19268; NEDMEHM |
Vector | pCMV6-Entry |
Sequence Data |
>SC329557 representing NM_001199758.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAAGATGAAATTGAGACAGAAGAGATCATCAAGGACATTTTCCAACGAGGCAAAATCTGCTTCATC CCTCGGTACCGGTTCCAGAGCAATCACATGGATATGGTGAGAATAGAATCACCAGAGGAAATTTCTTTA CTTCCCAAAACATCCTGGAATATCCCTCAGCCTGGTGAGGGTGATGTTCGGGAGGAGGCCTTGTCCACA GGGGGACTTGATCTCATCTTCATGCCAGGCCTTGGGTTTGACAAACATGGCAACCGACTGGGGAGGGGC AAGGGCTACTATGATGCCTATCTGAAGCGCTGTTTGCAGCATCAGGAAGTGAAGCCCTACACCCTGGCG TTGGCTTTCAAAGAACAGATTTGCCTCCAGGTCCCAGTGAATGAAAACGACATGAAGGTAGATGAAGTC CTTTACGAAGACTCGTCAACAGCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199758 |
Insert Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199758.1 |
RefSeq Size | 2293 bp |
RefSeq ORF | 441 bp |
Locus ID | 10588 |
UniProt ID | P49914 |
Protein Pathways | Metabolic pathways, One carbon pool by folate |
MW | 16.8 kDa |
Gene Summary | The protein encoded by this gene is an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231825 | MTHFS (Myc-DDK tagged) - Homo sapiens 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 2 |
CNY 3,990.00 |
|
RG231825 | MTHFS (tGFP-tagged) - Homo sapiens 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 2 |
CNY 4,370.00 |