United States
Germany
Japan
United Kingdom
China
Cadherin like 23 (CDH23) (NM_001171935) Human Untagged Clone
CAT＃: SC328409
CDH23 (untagged)-Human cadherin-related 23 (CDH23) transcript variant 8
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CDHR23; PITA5; USH1D |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001171935, the custom clone sequence may differ by one or more nucleotides
ATGCGGTCCTGGTTCCAGCAGGATCCTATGGTGGGAGCATGCACCACAGGCACCAGGGCC TCACACCCCAAAGCCAACCCTGTGTGGCTGGATCCCTTCTGTCGGAACCTGGAGCTGGCC GCCCAGGCGGAGCATGAGGATGACCTACCGGAGAACCTGAGTGAGATCGCCGACCTGTGG AACAGCCCCACGCGCACCCATGGAACTTTTGGGCGTGAGCCAGCAGCTGTCAAGCCTGAT GATGACCGATACCTGCGGGCTGCCATCCAGGAGTATGACAACATTGCCAAGCTGGGCCAG ATCATTCGTGAGGGGCCAATCAAGGGCTCGCTGCTGAAGGTGGTCCTGGAGGATTACCTG CGGCTCAAAAAGCTCTTTGCACAGCGGATGGTGCAAAAAGCCTCCTCCTGCCACTCCTCC ATCTCTGAGCTGATACAGACTGAGCTGGACGAGGAGCCAGGAGACCACAGCCCAGGGCAG GGTAGCCTGCGCTTCCGCCACAAGCCACCAGTGGAGCTCAAGGGGCCCGATGGGATCCAT GTGGTGCACGGCAGCACGGGCACGCTGCTGGCCACCGACCTCAACAGCCTGCCCGAGGAA GACCAGAAGGGCCTGGGCCGCTCGCTGGAGACGCTGACCGCTGCCGAGGCCACTGCCTTC GAGCGCAACGCCCGCACAGAATCCGCCAAATCCACACCCCTGCACAAACTTCGCGACGTG ATCATGGAGACCCCCCTGGAGATCACAGAGCTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001171935 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001171935.1, NP_001165406.1 |
| RefSeq Size | 1844 bp |
| RefSeq ORF | 756 bp |
| Locus ID | 64072 |
| UniProt ID | Q9H251 |
| Protein Families | Transmembrane |
| Gene Summary | This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013] Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (8, also referred to as isoform C1) has a distinct N-terminus and is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229771 | CDH23 (Myc-DDK-tagged)-Human cadherin-related 23 (CDH23), transcript variant 8 |
CNY 3,990.00 |
|
| RC229771L3 | Lenti-ORF clone of CDH23 (Myc-DDK-tagged)-Human cadherin-related 23 (CDH23), transcript variant 8 |
CNY 5,890.00 |
|
| RC229771L4 | Lenti-ORF clone of CDH23 (mGFP-tagged)-Human cadherin-related 23 (CDH23), transcript variant 8 |
CNY 5,890.00 |
|
| RG229771 | CDH23 (tGFP-tagged) - Human cadherin-related 23 (CDH23), transcript variant 8 |
CNY 4,370.00 |
