United States
Germany
Japan
United Kingdom
China
RIM1 (RIMS1) (NM_001168411) Human Untagged Clone
CAT＃: SC328351
RIMS1 (untagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1) transcript variant 6
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CORD7; RAB3IP2; RIM; RIM1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001168411, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCTGAAATGAGAAAGATGGTAAGGCAGCCGAGCCGAGAGTCTACTGATGGCAGC ATCAACAGTTACAGCTCTGAGGGCAATTTAATATTTCCTGGAGTGCGACTGGGAGCTGAC AGTCAATTCAGTGATTTTCTTGATGGATTGGGACCAGCCCAGCTTGTTGGCCGCCAAACC CTTGCCACCCCTGCAATGGGTGATATACAAATAGGAATGGAGGACAAAAAGGGCCAATTA GAAGTGGAAGTCATTAGAGCACGAAGCCTCACACAAAAGCCTGGTTCCAAATCTACACCT GCTCCATATGTCAAAGTATATCTTTTGGAAAATGGGGCCTGTATAGCCAAGAAGAAGACA AGAATTGCACGAAAAACCCTTGATCCTTTGTATCAGCAGTCTCTGGTTTTTGATGAAAGT CCACAGGGTAAAGTTCTTCAGGTGATTGTCTGGGGAGACTATGGCAGAATGGACCACAAA TGCTTTATGGGTGTGGCTCAGATCTTGTTGGAAGAACTCGACCTGTCCAGCATGGTGATC GGATGGTACAAATTGTTCCCACCGTCCTCACTGGTGGATCCCACACTCACTCCCCTCACC CGGCGGGCTTCCCAGTCATCTCTGGAAAGTTCAACTGGGCCTCCCTGTATTCGATCATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001168411 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001168411.1, NP_001161883.1 |
| RefSeq Size | 3286 bp |
| RefSeq ORF | 660 bp |
| Locus ID | 22999 |
| UniProt ID | Q86UR5 |
| Gene Summary | The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (6) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (6) is shorter at the N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229713 | RIMS1 (Myc-DDK-tagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
CNY 3,990.00 |
|
| RC229713L3 | Lenti-ORF clone of RIMS1 (Myc-DDK-tagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
CNY 5,890.00 |
|
| RC229713L4 | Lenti-ORF clone of RIMS1 (mGFP-tagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
CNY 5,890.00 |
|
| RG229713 | RIMS1 (tGFP-tagged) - Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
CNY 4,370.00 |
