United States
Germany
Japan
United Kingdom
China
IDE (NM_001165946) Human Untagged Clone
CAT＃: SC327546
IDE (untagged)-Human insulin-degrading enzyme (IDE) transcript variant 2
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | INSULYSIN |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001165946, the custom clone sequence may differ by one or more nucleotides
ATGAGCAAACTTTGGTTCAAACAAGATGATAAGTTTTTTTTGCCGAAGGCTTGTCTCAAC TTTGAATTTTTCAGCCCATTTGCTTATGTGGACCCCTTGCACTGTAACATGGCCTATTTG TACCTTGAGCTCCTCAAAGACTCACTCAACGAGTATGCATATGCAGCAGAGCTAGCAGGC TTGAGCTATGATCTCCAAAATACCATCTATGGGATGTATCTTTCAGTGAAAGGTTACAAT GACAAGCAGCCAATTTTACTAAAGAAGATTATTGAGAAAATGGCTACCTTTGAGATTGAT GAAAAAAGATTTGAAATTATCAAAGAAGCATATATGCGATCTCTTAACAATTTCCGGGCT GAACAGCCTCACCAGCATGCCATGTACTACCTCCGCTTGCTGATGACTGAAGTGGCCTGG ACTAAAGATGAGTTAAAAGAAGCTCTGGATGATGTAACCCTTCCTCGCCTTAAGGCCTTC ATACCTCAGCTCCTGTCACGGCTGCACATTGAAGCCCTTCTCCATGGAAACATAACAAAG CAGGCTGCATTAGGAATTATGCAGATGGTTGAAGACACCCTCATTGAACATGCTCATACC AAACCTCTCCTTCCAAGTCAGCTGGTTCGGTATAGAGAAGTTCAGCTCCCTGACAGAGGA TGGTTTGTTTATCAGCAGAGAAATGAAGTTCACAATAACTGTGGCATCGAGATATACTAC CAAACAGACATGCAAAGCACCTCAGAGAATATGTTTCTGGAGCTCTTCTGTCAGATTATC TCGGAACCTTGCTTCAACACCCTGCGCACCAAGGAGCAGTTGGGCTATATCGTCTTCAGC GGGCCACGTCGAGCTAATGGCATACAGGGCTTGAGATTCATCATCCAGTCAGAAAAGCCA CCTCACTACCTAGAAAGCAGAGTGGAAGCTTTCTTAATTACCATGGAAAAGTCCATAGAG GACATGACAGAAGAGGCCTTCCAAAAACACATTCAGGCATTAGCAATTCGTCGACTAGAC AAACCAAAGAAGCTATCTGCTGAGTGTGCTAAATACTGGGGAGAAATCATCTCCCAGCAA TATAATTTTGACAGAGATAACACTGAGGTTGCATATTTAAAGACACTTACCAAGGAAGAT ATCATCAAATTCTACAAGGAAATGTTGGCAGTAGATGCTCCAAGGAGACATAAGGTATCC GTCCATGTTCTTGCCAGGGAAATGGATTCTTGTCCTGTTGTTGGAGAGTTCCCATGTCAA AATGACATAAATTTGTCACAAGCACCAGCCTTGCCACAACCTGAAGTGATTCAGAACATG ACCGAATTCAAGCGTGGTCTGCCACTGTTTCCCCTTGTGAAACCACATATTAACTTCATG GCTGCAAAACTC |
| Restriction Sites | Please inquire |
| ACCN | NM_001165946 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001165946.1, NP_001159418.1 |
| RefSeq Size | 4480 bp |
| RefSeq ORF | 1395 bp |
| Locus ID | 3416 |
| UniProt ID | P14735 |
| Protein Families | Druggable Genome, Protease |
| Protein Pathways | Alzheimer's disease |
| Gene Summary | This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) lacks multiple exons that are present in the 5' end of variant 1. Variant 2 contains a novel exon at its 5' end and begins translation from a downstream in-frame start codon, compared to variant 1. The encoded protein (isoform 2) lacks 555 amino acids from the N-terminus of isoform 1 but is identical to its C-terminal 464 amino acids. Compared to isoform 1, isoform 2 lacks two of three M16 peptidase domains and the N-terminal catalytic domain. The C-terminus of isoform 2 retains the oligomerization domain and peroxisomal targeting sequence present in isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228911 | IDE (Myc-DDK-tagged)-Human insulin-degrading enzyme (IDE), transcript variant 2 |
CNY 10,170.00 |
|
| RC228911L3 | Lenti-ORF clone of IDE (Myc-DDK-tagged)-Human insulin-degrading enzyme (IDE), transcript variant 2 |
CNY 12,070.00 |
|
| RC228911L4 | Lenti-ORF clone of IDE (mGFP-tagged)-Human insulin-degrading enzyme (IDE), transcript variant 2 |
CNY 12,070.00 |
|
| RG228911 | IDE (tGFP-tagged) - Human insulin-degrading enzyme (IDE), transcript variant 2 |
CNY 11,210.00 |
