IVD (NM_001159508) Human Untagged Clone

CAT#: SC326953

IVD (untagged)-Human isovaleryl Coenzyme A dehydrogenase (IVD) transcript variant 2



  "NM_001159508" in other vectors (4)

CNY 6,460.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-IVD mouse monoclonal antibody, clone OTI1B10 (formerly 1B10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACAD2; IVDH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326953 representing NM_001159508.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGAGATGGCGACTGCGACTCGGCTGCTGGGGTGGCGTGTGGCGAGCTGGAGGCTGCGGCCGCCG
CTTGCCGGCTTCGTTTCCCAGCGGGCCCACTCGCTTTTGCCCGTGGACGATGCAATCAATGGGCTAAGC
GAGGAGCAGAGGCAGGAATTTTGGAAGCAGCTGGGGAACCTGGGCGTATTGGGCATCACAGCCCCTGTT
CAGTATGGCGGCTCCGGCCTGGGCTACCTGGAGCATGTGCTGGTGATGGAGGAGATATCCCGAGCTTCC
GGAGCAGTGGGGCTCAGTTACGGTGCCCACTCCAACCTCTGCATCAACCAGCTTGTACGCAATGGGAAT
GAGGCCCAGAAAGAGAAGTATCTCCCGAAGCTGATCAGTGGTGAGTACATCGGAGCCCTGGCCATGAGT
GAGCCCAATGCAGGCTCTGATGTTGTCTCTATGAAGCTCAAAGCGGAAAAGAAAGGAAATCACTACATC
CTGAATGGCAACAAGTTCTGGATCACTAATGGCCCTGATGCTGACGTCCTGATTGTCTATGCCAAGACA
GATCTGGCTGCTGTGCCAGCTTCTCGGGGCATCACAGCCTTCATTGTGGAGAAGGGTATGCCTGGCTTT
AGCACCTCTAAGAAGCTGGACAAGCTGGGGATGAGGGGCTCTAACACCTGTGAGCTAATCTTTGAAGAC
TGCAAGATTCCTGCTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGATGAGTGGGCTG
GACCTGGAGCGGCTGGTGCTGGCCGGGGGGCCTCTTGGGCTCATGCAAGCGGTCCTGGACCACACCATT
CCCTACCTGCACGTGAGGGAAGCCTTTGGCCAGAAGATCGGCCACTTCCAGTTGATGCAGGGGAAGATG
GCTGACATGTACACCCGCCTCATGGCGTGTCGGCAGTATGTCTACAATGTCGCCAAGGCCTGCGATGAG
GGCCATTGCACTGCTAAGGACTGTGCAGGTGTGATTCTTTACTCAGCTGAGTGTGCCACACAGGTAGCC
CTGGACGGCATTCAGTGTTTTGGTGGCAATGGCTACATCAATGACTTTCCCATGGGCCGCTTTCTTCGA
GATGCCAAGCTGTATGAGATAGGGGCTGGGACCAGCGAGGTGAGGCGGCTGGTCATCGGCAGAGCCTTC
AATGCAGACTTTCACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001159508
Insert Size 1191 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001159508.1
RefSeq Size 4575 bp
RefSeq ORF 1191 bp
Locus ID 3712
UniProt ID P26440
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Valine, leucine and isoleucine degradation
MW 43.1 kDa
Gene Summary Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (2) lacks an in-frame coding exon in the 5' coding region compared to variant 1. The resulting shorter isoform (2) lacks an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus, annotating a downstream start codon, to one that is more supported by available conservation data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...