Ataxin 3 (ATXN3) (NM_001164780) Human Untagged Clone

CAT#: SC326752

ATXN3 (untagged)-Human ataxin 3 (ATXN3) transcript variant u



  "NM_001164780" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ATXN3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AT3; ATX3; JOS; MJD; MJD1; SCA3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164780, the custom clone sequence may differ by one or more nucleotides
ATGATTAGGGTCCAACAGATGCATCGACCAAAACTTATTGGAGAAGAATTAGCACAACTA
AAAGAGCAAAGAGTCCATAAAACAGACCTGGAACGAGTGTTAGAAGCAAATGATGGCTCA
GGAATGTTAGACGAAGATGAGGAGGATTTGCAGAGGGCTCTGGCACTAAGTCGCCAAGAA
ATTGACATGGAAGATGAGGAAGCAGATCTCCGCAGGGCTATTCAGCTAAGTATGCAAGGT
AGTTCCAGAAACATATCTCAAGATATGACACAGACATCAGGTACAAATCTTACTTCAGAA
GAGCTTCGGAAGAGACGAGAAGCCTACTTTGAAAAACAGCAGCAAAAGCAGCAACAGCAG
CAGCAGCAGCAGCAGCAGGGGGACCTATCAGGACAGAGTTCACATCCATGTGAAAGGCCA
GCCACCAGTTCAGGAGCACTTGGGAGTGATCTAGGTGATGCTATGAGTGAAGAAGACATG
CTTCAGGCAGCTGTGACCATGTCTTTAGAAACTGTCAGAAATGATTTGAAAACAGAAGGA
AAAAAA
Restriction Sites Please inquire     
ACCN NM_001164780
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164780.1, NP_001158252.1
RefSeq Size 6627 bp
RefSeq ORF 549 bp
Locus ID 4287
UniProt ID P54252
Protein Families Druggable Genome, Transcription Factors
Gene Summary Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (u) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform u. PMID:19714377 predicts that this is a noncoding transcript, but there is a downstream orf that may encode a protein identical to the C-terminus of the reference isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...