Mu Opioid Receptor (OPRM1) (NM_001145279) Human Untagged Clone

CAT#: SC325995

OPRM1 (untagged)-Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-1H



  "NM_001145279" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Mu Opioid Receptor(MOR) Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LMOR; M-OR-1; MOP; MOR; MOR1; OPRM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145279, the custom clone sequence may differ by one or more nucleotides


ATGTGTTTGCACAGAAGAGTGCCCAGTGAAGAGACCTACTCCTTGGATCGCTTTGCGCAAAATCCACCCC
TTTTCCCTCCTCCCTCCCTTCCAGCCTCCGAATCCCGCATGGCCCACGCTCCCCTCCTGCAGCGGTGCGG
GGCAGCCAGGACTGGTTTCTGTAAGAAACAGCAGGAGCTGTGGCAGCGGCGAAAGGAAGCGGCTGAGGCG
CTTGGAACCCGAAAAGTCTCGGTGCTCCTGGCTACCTCGCACAGCGGTGCCCGCCCGGCCGTCAGTACCA
TGGACAGCAGCGCTGCCCCCACGAACGCCAGCAATTGCACTGATGCCTTGGCGTACTCAAGTTGCTCCCC
AGCACCCAGCCCCGGTTCCTGGGTCAACTTGTCCCACTTAGATGGCAACCTGTCCGACCCATGCGGTCCG
AACCGCACCGACCTGGGCGGGAGAGACAGCCTGTGCCCTCCGACCGGCAGTCCCTCCATGATCACGGCCA
TCACGATCATGGCCCTCTACTCCATCGTGTGCGTGGTGGGGCTCTTCGGAAACTTCCTGGTCATGTATGT
GATTGTCAGATACACCAAGATGAAGACTGCCACCAACATCTACATTTTCAACCTTGCTCTGGCAGATGCC
TTAGCCACCAGTACCCTGCCCTTCCAGAGTGTGAATTACCTAATGGGAACATGGCCATTTGGAACCATCC
TTTGCAAGATAGTGATCTCCATAGATTACTATAACATGTTCACCAGCATATTCACCCTCTGCACCATGAG
TGTTGATCGATACATTGCAGTCTGCCACCCTGTCAAGGCCTTAGATTTCCGTACTCCCCGAAATGCCAAA
ATTATCAATGTCTGCAACTGGATCCTCTCTTCAGCCATTGGTCTTCCTGTAATGTTCATGGCTACAACAA
AATACAGGCAAGGTTCCATAGATTGTACACTAACATTCTCTCATCCAACCTGGTACTGGGAAAACCTGCT
GAAGATCTGTGTTTTCATCTTCGCCTTCATTATGCCAGTGCTCATCATTACCGTGTGCTATGGACTGATG
ATCTTGCGCCTCAAGAGTGTCCGCATGCTCTCTGGCTCCAAAGAAAAGGACAGGAATCTTCGAAGGATCA
CCAGGATGGTGCTGGTGGTGGTGGCTGTGTTCATCGTCTGCTGGACTCCCATTCACATTTACGTCATCAT
TAAAGCCTTGGTTACAATCCCAGAAACTACGTTCCAGACTGTTTCTTGGCACTTCTGCATTGCTCTAGGT
TACACAAACAGCTGCCTCAACCCAGTCCTTTATGCATTTCTGGATGAAAACTTCAAACGATGCTTCAGAG
AGTTCTGTATCCCAACCTCTTCCAACATTGAGCAACAAAACTCCACTCGAATTCGTCAGAACACTAGAGA
CCACCCCTCCACGGCCAATACAGTGGATAGAACTAATCATCAGCTAGAAAATCTGGAAGCAGAAACTGCT
CCGTTGCCCTAA


Restriction Sites Please inquire     
ACCN NM_001145279
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145279.1, NP_001138751.1
RefSeq Size 2738 bp
RefSeq ORF 1482 bp
Locus ID 4988
UniProt ID P35372
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes one of at least three opioid receptors in humans; the mu opioid receptor (MOR). The MOR is the principal target of endogenous opioid peptides and opioid analgesic agents such as beta-endorphin and enkephalins. The MOR also has an important role in dependence to other drugs of abuse, such as nicotine, cocaine, and alcohol via its modulation of the dopamine system. The NM_001008503.2:c.118A>G allele has been associated with opioid and alcohol addiction and variations in pain sensitivity but evidence for it having a causal role is conflicting. Multiple transcript variants encoding different isoforms have been found for this gene. Though the canonical MOR belongs to the superfamily of 7-transmembrane-spanning G-protein-coupled receptors some isoforms of this gene have only 6 transmembrane domains. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (MOR-1i) encodes the longest isoform (MOR-1i). Variants MOR-1i and MOR-1CA encode the same isoform (MOR-1i). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...