NEK6 (NM_001145001) Human Untagged Clone

CAT#: SC325800

NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1



  "NM_001145001" in other vectors (6)

CNY 5,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
NEK6 mouse monoclonal antibody, clone OTI5D7 (formerly 5D7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SID6-1512
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325800 representing NM_001145001.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCAGGAGAGAAGTTTGCTGGGAGGCAGCTCATTTCCGGCAGGAGGAGCAGAGCCTGCCAAGGCCT
CGAGTTCGTGCCCTCGTGAGGCTGGCATGCAGGATGGCAGGACAGCCCGGCCACATGCCCCATGGAGGG
AGTTCCAACAACCTCTGCCACACCCTGGGGCCTGTGCATCCTCCTGACCCACAGAGGCATCCCAACACG
CTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAGATCGAAAAGAAGATAGGCCGAGGACAGTTCAGCGAG
GTGTACAAGGCCACCTGCCTGCTGGACAGGAAGACAGTGGCTCTGAAGAAGGTGCAGATCTTTGAGATG
ATGGACGCCAAGGCGAGGCAGGACTGTGTCAAGGAGATCGGCCTCTTGAAGCAACTGAACCACCCAAAT
ATCATCAAGTATTTGGACTCGTTTATCGAAGACAACGAGCTGAACATTGTGCTGGAGTTGGCTGACGCA
GGGGACCTCTCGCAGATGATCAAGTACTTTAAGAAGCAGAAGCGGCTCATCCCGGAGAGGACAGTATGG
AAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAGCACATGCATTCACGCCGGGTGATGCACCGAGACATC
AAGCCTGCCAACGTGTTCATCACAGCCACGGGCGTCGTGAAGCTCGGTGACCTTGGTCTGGGCCGCTTC
TTCAGCTCTGAGACCACCGCAGCCCACTCCCTAGTGGGGACGCCCTACTACATGTCACCGGAGAGGATC
CATGAGAACGGCTACAACTTCAAGTCCGACATCTGGTCCCTGGGCTGTCTGCTGTACGAGATGGCAGCC
CTCCAGAGCCCCTTCTATGGAGATAAGATGAATCTCTTCTCCCTGTGCCAGAAGATCGAGCAGTGTGAC
TACCCCCCACTCCCCGGGGAGCACTACTCCGAGAAGTTACGAGAACTGGTCAGCATGTGCATCTGCCCT
GACCCCCACCAGAGACCTGACATCGGATACGTGCACCAGGTGGCCAAGCAGATGCACATCTGGATGTCC
AGCACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145001
Insert Size 1044 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145001.2
RefSeq Size 2810 bp
RefSeq ORF 1044 bp
Locus ID 10783
UniProt ID Q9HC98
Protein Families Druggable Genome, Protein Kinase
MW 39.8 kDa
Gene Summary The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Variants 1 and 7 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...