ALG5 (NM_001142364) Human Untagged Clone

CAT#: SC325725

ALG5 (untagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 2



  "NM_001142364" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ALG5 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA421P11.2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325725 representing NM_001142364.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCCGCTTCTGTTGCAGCTGGCGGTGCTCGGCGCGGCGCTGGCGGCCGCAGCCCTCGTACTGATT
TCCATCGTTGCATTTACAACTGCTACAAAAATGCCAGCACTCCATCGACATGAAGAAGAGAAATTCTTC
TTAAATGCCAAAGGCCAGAAAGAAACTTTACCCAGCATATGGGACTCACCTACCAAACAACTTTCTGTC
GTTGTGCCTTCATACAATGAAGAAAAACGGTTGCCTGTGATGATGGATGAAGCTCTGAGCTATCTAGAG
AAGAGACAGAAATATGGAAGTGACAAAGTACGTGTGATAACCCTGGTGAAGAATCGTGGAAAAGGTGGA
GCGATTAGAATGGGTATATTCAGTTCTCGAGGAGAAAAGATCCTTATGGCAGATGCTGATGGAGCCACA
AAGTTTCCAGATGTTGAGAAATTAGAAAAGGGGCTAAATGATCTACAGCCTTGGCCTAATCAAATGGCT
ATAGCATGTGGATCTCGAGCTCATTTAGAAAAAGAATCAATTGCTCAGCGTTCTTACTTCCGTACTCTT
CTCATGTATGGGTTCCACTTTCTGGTGTGGTTCCTTTGTGTCAAAGGAATCAGGGACACACAGTGTGGG
TTCAAATTATTTACTCGAGAAGCAGCTTCACGGACGTTTTCATCTCTACACGTTGAACGATGGGCATTT
GATGTAGAACTACTGTACATAGCACAGTTCTTTAAAATTCCAATAGCAGAAATTGCTGTCAACTGGACA
GAAATTGAAGGTTCTAAATTAGTTCCATTCTGGAGCTGGCTACAAATGGGTAAAGACCTACTTTTTATA
CGACTTCGATATTTGACTGGTGCCTGGAGGCTTGAGCAAACTCGGAAAATGAATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142364
Insert Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142364.1
RefSeq Size 1137 bp
RefSeq ORF 885 bp
Locus ID 29880
UniProt ID Q9Y673
Protein Families Transmembrane
Protein Pathways Metabolic pathways, N-Glycan biosynthesis
MW 33.5 kDa
Gene Summary This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...