TSH Receptor (TSHR) (NM_001142626) Human Untagged Clone
CAT#: SC325694
TSHR (untagged)-Human thyroid stimulating hormone receptor (TSHR), transcript variant 3
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHNG1; hTSHR-I; LGR3 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001142626 edited
ATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGC GGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCACC TGCAAGGATATTCAACGCATCCCCAGCTTACCGCCCAGTACGCAGACTCTGAAGCTTATT GAGACTCACCTGAGAACTATTCCAAGTCATGCATTTTCTAATCTGCCCAATATTTCCAGA ATCTACGTATCTATAGATGTGACTCTGCAGCAGCTGGAATCACACTCCTTCTACAATTTG AGTAAAGTGACTCACATAGAAATTCGGAATACCAGGAACTTAACTTACATAGACCCTGAT GCCCTCAAAGAGCTCCCCCTCCTAAAGTTCCTTGGCATTTTCAACACTGGACTTAAAATG TTCCCTGACCTGACCAAAGTTTATTCCACTGATATATTCTTTATACTTGAAATTACAGAC AACCCTTACATGACGTCAATCCCTGTGAATGCTTTTCAGGGACTATGCAATGAAACCTTG ACACTGAAGCTGTACAACAATGGCTTTACTTCAGTCCAAGGATATGCTTTCAATGGGACA AAGCTGGATGCTGTTTACCTAAACAAGAATAAATACCTGACAGTTATTGACAAAGATGCA TTTGGAGGAGTATACAGTGGACCAAGCTTGCTGGTAGAAAATGTTGCTGTCTCGGGTAAA GGCTTCTGCAAGTCCCTCTTTTCCTGGCTGTATAGGCTACCTCTTGGAAGAAAGTCCTTG TCCTTTGAGACTCAGAAGGCCCCACGCTCCAGTATGCCATCATGA |
Restriction Sites | Please inquire |
ACCN | NM_001142626 |
Insert Size | 1200 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142626.1, NP_001136098.1 |
RefSeq Size | 1246 bp |
RefSeq ORF | 825 bp |
Locus ID | 7253 |
UniProt ID | P16473 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Autoimmune thyroid disease, Neuroactive ligand-receptor interaction |
Gene Summary | The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence and uses an alternate in-frame splice junction compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus and contains an alternate internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226653 | TSHR (Myc-DDK-tagged)-Human thyroid stimulating hormone receptor (TSHR), transcript variant 3 |
CNY 3,600.00 |
|
RC226653L3 | Lenti ORF clone of Human thyroid stimulating hormone receptor (TSHR), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226653L4 | Lenti ORF clone of Human thyroid stimulating hormone receptor (TSHR), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG226653 | TSHR (tGFP-tagged) - Human thyroid stimulating hormone receptor (TSHR), transcript variant 3 |
CNY 4,370.00 |
其它TSH Receptor产品