FMO5 (NM_001144830) Human Untagged Clone
CAT#: SC324881
FMO5 (untagged)-Human flavin containing monooxygenase 5 (FMO5), transcript variant 3
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hBVMO1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001144830, the custom clone sequence may differ by one or more nucleotides
ATGACTAAGAAAAGAATTGCTGTGATTGGGGGAGGAGTGAGCGGGCTCTCTTCCATCAAG TGCTGCGTAGAAGAAGGCTTGGAACCTGTCTGCTTTGAAAGGACTGATGACATCGGAGGG CTCTGGAGGTTCCAGGAAAATCCTGAAGAAGGAAGGGCCAGTATTTACAAATCAGTGATC ATCAATACTTCTAAAGAGATGATGTGCTTCAGTGACTATCCAATCCCAGATCATTATCCC AACTTCATGCATAATGCCCAGGTCCTGGAGTATTTCAGGATGTATGCCAAAGAATTTGAC CTTCTAAAGTATATTCGATTTAAGACCACTGTGTGCAGTGTGAAGAAGCAGCCTGATTTT GCCACTTCAGGCCAATGGGAAGTGGTCACTGAATCTGAAGGGAAAAAGGAGATGAATGTC TTTGATGGAGTCATGGTTTGCACTGGCCATCACACCAATGCTCATCTACCTCTGGAAAGC TTCCCTGGAATTGAGAAGTTCAAAGGGCAGTACTTCCACAGTCGAGACTATAAGAACCCA GAGGGATTCACTGGAAAGAGAGTCATTATAATTGGCATTGGGAATTCTGGAGGGGATCTG GCTGTAGAGATTAGCCAAACAGCCAAGCAGGTTTTCCTCAGCACCAGGAGAGGGGCTTGG ATCCTGAATCGTGTAGGGGACTACGGATATCCTGCTGATGTGTTGTTCTCTTCTCGACTT ACACATTTTATATGGAAGATCTGTGGCCAATCATTAGCAAACAAATATTTGGAAAAAAAG ATAAACCAAAGGTTTGACCATGAAATGTTTGGCCTGAAGCCTAAACACAGGTCTAAAGAC ATTGCCCTCACAGAG |
Restriction Sites | Please inquire |
ACCN | NM_001144830 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001144830.1, NP_001138302.1 |
RefSeq Size | 2499 bp |
RefSeq ORF | 858 bp |
Locus ID | 2330 |
UniProt ID | P49326 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450 |
Gene Summary | Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009] Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate exon in the 3' coding region, compared to variant 1. This results in a frameshift and shorter protein (isoform 3), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226537 | FMO5 (Myc-DDK-tagged)-Human flavin containing monooxygenase 5 (FMO5), transcript variant 3 |
CNY 3,990.00 |
|
RC226537L3 | Lenti-ORF clone of FMO5 (Myc-DDK-tagged)-Human flavin containing monooxygenase 5 (FMO5), transcript variant 3 |
CNY 5,890.00 |
|
RC226537L4 | Lenti-ORF clone of FMO5 (mGFP-tagged)-Human flavin containing monooxygenase 5 (FMO5), transcript variant 3 |
CNY 5,890.00 |
|
RG226537 | FMO5 (tGFP-tagged) - Human flavin containing monooxygenase 5 (FMO5), transcript variant 3 |
CNY 4,370.00 |