C9orf95 (NMRK1) (NM_001127603) Human Untagged Clone
CAT#: SC322868
NMRK1 (untagged)-Human chromosome 9 open reading frame 95 (C9orf95), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA235O14.2; C9orf95; NRK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322868 representing NM_001127603.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAACATTTATCATTGGAATCAGTGGTGTGACAAACAGTGGCAAAACAACACTGGCTAAGAATTTG CAGAAACACCTCCCAAATTGCAGTGTCATATCTCAGGATGATTTCTTCAAGCCAGAGTCTGAGATAGAG ACAGATAAAAATGGATTTTTGCAGTACGATGTGCTTGAAGCACTTAACATGGAAAAAATGATGTCAGCC ATTTCCTGCTGGATGGAAAGCGCAAGACACTCTGTGGTATCAACAGACCAGGAAAGTGCTGAGGAAATT CCCATTTTAATCATCGAAGGTTTTCTTCTTTTTAATTATAATACAAGGGTCTATCAGCCTCCAGACTCT CCGGGATACTTTGATGGCCATGTGTGGCCCATGTATCTAAAGTACAGACAAGAAATGCAGGACATCACA TGGGAAGTTGTGTACCTGGATGGAACAAAATCTGAAGAGGACCTCTTTTTGCAAGTATATGAAGATCTA ATACAAGAACTAGCAAAGCAAAAGTGTTTGCAAGTGACAGCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127603 |
Insert Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127603.1 |
RefSeq Size | 1147 bp |
RefSeq ORF | 528 bp |
Locus ID | 54981 |
UniProt ID | Q9NWW6 |
Protein Pathways | Nicotinate and nicotinamide metabolism |
MW | 20.2 kDa |
Gene Summary | Nicotinamide adenine dinucleotide (NAD+) is essential for life in all organisms, both as a coenzyme for oxidoreductases and as a source of ADP-ribosyl groups used in various reactions. Nicotinic acid and nicotinamide, collectively known as niacin, are the vitamin precursors of NAD+. Nicotinamide riboside kinases, such as NRK1, function to synthesize NAD+ through nicotinamide mononucleotide using nicotinamide riboside as the precursor (Bieganowski and Brenner, 2004 [PubMed 15137942]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225183 | NMRK1 (Myc-DDK-tagged)-Human chromosome 9 open reading frame 95 (C9orf95), transcript variant 2 |
CNY 2,400.00 |
|
RC225183L3 | Lenti ORF clone of Human chromosome 9 open reading frame 95 (C9orf95), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225183L4 | Lenti ORF clone of Human chromosome 9 open reading frame 95 (C9orf95), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225183 | NMRK1 (tGFP-tagged) - Human chromosome 9 open reading frame 95 (C9orf95), transcript variant 2 |
CNY 4,370.00 |
其它C9orf95产品