C9orf95 (NMRK1) (NM_001127603) Human Untagged Clone

CAT#: SC322868

NMRK1 (untagged)-Human chromosome 9 open reading frame 95 (C9orf95), transcript variant 2



  "NM_001127603" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C9orf95 Antibody - N-terminal region
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA235O14.2; C9orf95; NRK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322868 representing NM_001127603.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAAACATTTATCATTGGAATCAGTGGTGTGACAAACAGTGGCAAAACAACACTGGCTAAGAATTTG
CAGAAACACCTCCCAAATTGCAGTGTCATATCTCAGGATGATTTCTTCAAGCCAGAGTCTGAGATAGAG
ACAGATAAAAATGGATTTTTGCAGTACGATGTGCTTGAAGCACTTAACATGGAAAAAATGATGTCAGCC
ATTTCCTGCTGGATGGAAAGCGCAAGACACTCTGTGGTATCAACAGACCAGGAAAGTGCTGAGGAAATT
CCCATTTTAATCATCGAAGGTTTTCTTCTTTTTAATTATAATACAAGGGTCTATCAGCCTCCAGACTCT
CCGGGATACTTTGATGGCCATGTGTGGCCCATGTATCTAAAGTACAGACAAGAAATGCAGGACATCACA
TGGGAAGTTGTGTACCTGGATGGAACAAAATCTGAAGAGGACCTCTTTTTGCAAGTATATGAAGATCTA
ATACAAGAACTAGCAAAGCAAAAGTGTTTGCAAGTGACAGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127603
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127603.1
RefSeq Size 1147 bp
RefSeq ORF 528 bp
Locus ID 54981
UniProt ID Q9NWW6
Protein Pathways Nicotinate and nicotinamide metabolism
MW 20.2 kDa
Gene Summary Nicotinamide adenine dinucleotide (NAD+) is essential for life in all organisms, both as a coenzyme for oxidoreductases and as a source of ADP-ribosyl groups used in various reactions. Nicotinic acid and nicotinamide, collectively known as niacin, are the vitamin precursors of NAD+. Nicotinamide riboside kinases, such as NRK1, function to synthesize NAD+ through nicotinamide mononucleotide using nicotinamide riboside as the precursor (Bieganowski and Brenner, 2004 [PubMed 15137942]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...