Bcl2 Binding component 3 (BBC3) (NM_001127242) Human Untagged Clone

CAT#: SC322807

BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 3



  "NM_001127242" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-BBC3 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms JFY-1; JFY1; PUMA
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001127242, the custom clone sequence may differ by one or more nucleotides
ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC
ACGACGTGGGTCCCCTGCCAGATTTGTGAGACAAGAGGAGCAGCAGCGGCACCGCCCCTC
ACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAG
AGCCCCCGAGATGGAGCCCAATTAGGTGCCTGCACCCGCCCGGTGGACGTCAGGGACTCG
GGGGGCAGGCCCCTCCCACCTCCTGACACCCTGGCCAGCGCGGGGGACTTTCTCTGCACC
ATG
Restriction Sites Please inquire     
ACCN NM_001127242
Insert Size 1359 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127242.1, NP_001120714.1
RefSeq Size 1359 bp
RefSeq ORF 1359 bp
Locus ID 27113
UniProt ID Q9BXH1
Protein Families Druggable Genome
Protein Pathways Huntington's disease, p53 signaling pathway
Gene Summary This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) lacks two exons spanning the 5' and central coding regions, resulting in a frameshift in the 3' coding region, compared to variant 2. The encoded isoform (3, also known as PUMA-delta) has the same N-terminus but is otherwise distinct and shorter, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...