CART (CARTPT) (NM_004291) Human Untagged Clone

CAT#: SC322555

CARTPT (untagged)-Human CART prepropeptide (CARTPT)



  "NM_004291" in other vectors (7)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CARTPT rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CART
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004291 edited
GGTTGACCCGGGCCCTCCTCCACACCCCCTTCCTTCTTCGCCTCCTCCCTCTTTCCTGCA
CGGGGGCTCGGGCTCACTATAAAAGGTGGGAGCGCGTGGTGCCCCAGCAACGACGAGTTT
CAGAACGATGGAGAGCTCCCGCGTGAGGCTGCTGCCCCTCCTGGGCGCCGCCCTGCTGCT
GATGCTACCTCTGTTGGGTACCCGTGCCCAGGAGGACGCCGAGCTCCAGCCCCGAGCCCT
GGACATCTACTCTGCCGTGGATGATGCCTCCCACGAGAAGGAGCTGATCGAAGCGCTGCA
AGAAGTCTTGAAGAAGCTCAAGAGTAAACGTGTTCCCATCTATGAGAAGAAGTATGGCCA
AGTCCCCATGTGTGACGCCGGTGAGCAGTGTGCAGTGAGGAAAGGGGCAAGGATCGGGAA
GCTGTGTGACTGTCCCCGAGGAACCTCCTGCAATTCCTTCCTCCTGAAGTGCTTATGAAG
GGGCGTCCATTCTCCTCCATACATCCCCATCCCTCTACTTTCCCCAGAGGACCACACCTT
CCTCCCTGGAGTTTGGCTTAAGCAACAGATAAAGTTTTTATTTTCCTCTGAAGGGAAAGG
GCTCTTTTCCTGCTGTTTCAAAAATAAAAGAACACATTAGAAAAAAAAAAAAAAAAAAAA
AAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004291
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004291.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004291.2, NP_004282.1
RefSeq Size 908 bp
RefSeq ORF 351 bp
Locus ID 9607
UniProt ID Q16568
Protein Families Secreted Protein
Gene Summary This gene encodes a preproprotein that is proteolytically processed to generate multiple biologically active peptides. These peptides play a role in appetite, energy balance, maintenance of body weight, reward and addiction, and the stress response. Expression of a similar gene transcript in rodents is upregulated following administration of cocaine and amphetamine. Mutations in this gene are associated with susceptibility to obesity in humans. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...