ATP5F1C (NM_001001973) Human Untagged Clone

CAT#: SC322171

ATP5C1 (untagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (ATP5C1), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_001001973" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
ATP5C1 mouse monoclonal antibody,clone OTI2H6
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP5C; ATP5C1; ATP5CL1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322171 CGCATGCGCGCTGAGGCCTGCCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTC
TCGCGCGGGTGTCGCTGGGCTGTCGGCCTGGACCTTGCAGCCGCAATGGATTCAAGTTCG
AAATATGGCAACTTTGAAAGATATCACCAGGAGACTAAAGTCCATCAAAAACATCCAGAA
AATTACCAAGTCTATGAAAATGGTAGCGGCAGCAAAATATGCCCGAGCTGAGAGAGAGCT
GAAACCAGCTCGAATATATGGATTGGGATCTTTAGCTCTGTATGAAAAAGCTGATATCAA
GGGGCCTGAAGACAAGAAGAAACACCTCCTTATTGGTGTGTCCTCAGATCGAGGACTGTG
TGGTGCTATTCATTCCTCCATTGCTAAACAGATGAAAAGCGAGGTTGCTACACTAACAGC
AGCTGGGAAAGAAGTTATGCTTGTTGGAATTGGTGACAAAATCAGAGGCATACTTTATAG
GACTCATTCTGACCAGTTTCTGGTGGCATTCAAAGAAGTGGGAAGAAAGCCCCCCACTTT
TGGAGATGCGTCAGTCATTGCCCTTGAATTACTAAATTCTGGATATGAATTTGATGAAGG
CTCCATCATCTTTAATAAATTCAGGTCTGTCATCTCCTATAAGACAGAAGAAAAGCCCAT
CTTTTCCCTTAATACCGTTGCAAGTGCTGACAGCATGAGTATCTATGACGATATTGATGC
TGACGTGCTGCAAAATTACCAAGAATACAATCTGGCCAACATCATCTACTACTCTCTGAA
GGAGTCCACCACTAGTGAGCAGAGTGCCAGGATGACAGCCATGGACAATGCCAGCAAGAA
TGCTTCTGAGATGATTGACAAATTGACATTGACATTCAACCGTACCCGCCAAGCTGTCAT
CACAAAAGAGTTGATTGAAATTATCTCTGGTGCTGCAGCTCTGGATTAATGAAAATCAAG
TTCCATCCTCAGACAAGAGGTAAAGAAGGAAAATTCAGCCAGTTGATTTTGTTTTTAGCT
TACTGCTGCCTTTGTCCGAAGAAACCGTTCCTCCATTATTTGAATTACTGAAGACAGCAA
GATATTTGTAAATTATCTTAAAATAAACAACTTAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001001973
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001973.1, NP_001001973.1
RefSeq Size 1162 bp
RefSeq ORF 897 bp
Locus ID 509
UniProt ID P36542
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript, and encodes the longest isoform (L), also known as a liver type isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...