HSPC142 (BABAM1) (NM_001033549) Human Untagged Clone
CAT#: SC322038
BABAM1 (untagged)-Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C19orf62; HSPC142; MERIT40; NBA1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322038
CGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAGGAGGTTCAGGCTACGGTGAGCCGAAG
GGGAGGATTCTGGCTTCCCCTGTCCGTGTTCCATCTAGCCACACAGGAGCCATGGAAGTG GCAGAGCCCAGCAGCCCCACTGAAGAGGAGGAGGAGGAAGAGGAGCACTCGGCAGAGCCT CGGCCCCGCACTCGCTCCAATCCTGAAGGGGCTGAGGACCGGGCAGTAGGGGCACAGGCC AGCGTGGGCAGCCGCAGCGAGGGTGAGGGTGAGGCCGCCAGTGCTGATGATGGGAGCCTC AACACTTCAGGAGCCGGCCCTAAGTCCTGGCAGGTGCCCCCGCCAGCCCCTGAGGTCCAA ATTCGGACACCAAGGGTCAACTGTCCAGAGAAAGTGATTATCTGCCTGGACCTGTCAGAG GAAATGTCACTGCCAAAGCTGGAGTCGTTCAACGGCTCCAAAACCAACGCCCTCAATGTC TCCCAGAAGATGATTGAGATGTTCGTGCGGACAAAACACAAGATCGACAAAAGCCACGAG TTTGCACTGGTGGTGGTGAACGATGACACGGCCTGGCTGTCTGGCCTGACCTCCGACCCC CGCGAGCTCTGTAGCTGCCTCTATGATCTGGAGACGGCCTCCTGTTCCACCTTCAATCTG GAAGGACTTTTCAGCCTCATCCAGCAGAAAACTGAGCTTCCGGTCACAGAGAACGTGCAG ACGATTCCCCCGCCATATGTGGTCCGCACCATCCTTGTCTACAGCCGTCCACCTTGCCAG CCCCAGTTCTCCTTGACGGAGCCCATGAAGAAAATGTTCCAGTGCCCATATTTCTTCTTT GACGTTGTTTACATCCACAATGGCACTGAGGAGAAGGAGGAGGAGATGAGTTGGAAGGAT ATGTTTGCCTTCATGGGCAGCCTGGATACCAAGGGTACCAGCTACAAGTATGAGGTGGCA CTGGCTGGGCCAGCCCTGGAGTTGCACAACTGCATGGCGAAACTGTTGGCCCACCCCCTG CAGCGGCCTTGCCAGAGCCATGCTTCCTACAGCCTGCTGGAGGAGGAGGATGAAGCCATT GAGGTTGAGGCCACTGTCTGAACCATCCCTGTACATCTGCACCTTCTTGTGCAAGGAAGT CCTTGGCCTAAAGCCTTGGTTCTCAAACTGGGTTCCTTGGGACCTCCGGGGTGGGGGGGT TCCAGGAGGCACGTAGGGTACCTTGCAGGGTCCTAGGAGGGAAACCCAGGATTCCAGGAG GGATCCCAGGAACTGTGGGCACCCATTTTCTGTGTCTCCCAGCCCATTTCCACTCCTAGT TTGTCATGGATAATTTTTGTTCTTCCCTGTGTGATTTTTGCCATCAAAATAAAAATTTGA GACTCGTTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001033549 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033549.1, NP_001028721.1 |
RefSeq Size | 1451 bp |
RefSeq ORF | 990 bp |
Locus ID | 29086 |
UniProt ID | Q9NWV8 |
Gene Summary | Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. In the BRCA1-A complex, it is required for the complex integrity and its localization at DSBs. Component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates (PubMed:24075985, PubMed:26195665). In these 2 complexes, it is probably required to maintain the stability of BABAM2 and help the 'Lys-63'-linked deubiquitinase activity mediated by BRCC3/BRCC36 component. The BRISC complex is required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1 (PubMed:26195665). Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression (PubMed:24075985). Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination (PubMed:24075985).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) is the longest transcript and encodes the longer isoform (1). Variants 1, 2 and 3 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210626 | BABAM1 (Myc-DDK-tagged)-Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1 |
CNY 2,400.00 |
|
RC210626L1 | Lenti ORF clone of Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210626L2 | Lenti ORF clone of Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC210626L3 | Lenti ORF clone of Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210626L4 | Lenti ORF clone of Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG210626 | BABAM1 (tGFP-tagged) - Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 1 |
CNY 4,000.00 |
其它HSPC142产品