United States
Germany
Japan
United Kingdom
China
FXYD2 (NM_021603) Human Untagged Clone
CAT＃: SC320832
FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ATP1G1; HOMG2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_021603.2
GCCACTCTCCATCCAGGCCCCAGGCAAGCAGCACCTCCCTGCTCTTCTGCACTCCTGGAC
ACAACCAGCAGCTCCTGCCATGGACAGGTGGTACCTGGGCGGCAGCCCCAAGGGGGACGT GGACCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACT GGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAA GAAGCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGCGGTGCCACCCACT GCACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCC TGGGCTTTAGACCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAGGAAGCTCCAGACT CAATGTGACCCCCAGGTGGCATCGCCAACGCCTGCCTCGTGCCACCTCATGCTTATAATA AAGCCGGCGTCAGAGACCGCTGCTTCCCTCACCAAAAAAATAAAAAAAAAAAAAAAAAAA AAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_021603 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_021603.2, NP_067614.1 |
| RefSeq Size | 578 bp |
| RefSeq ORF | 195 bp |
| Locus ID | 486 |
| UniProt ID | P54710 |
| Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
| Gene Summary | This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (b) contains an alternate 5' terminal exon compared to transcript variant a, resulting in a slightly shorter isoform (2) with a distinct N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202739 | FXYD2 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b |
CNY 1,200.00 |
|
| RC202739L1 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC202739L2 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, mGFP tagged |
CNY 5,890.00 |
|
| RC202739L3 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202739L4 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, mGFP tagged |
CNY 5,890.00 |
|
| RG202739 | FXYD2 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b |
CNY 2,800.00 |
|
| SC304942 | FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b |
CNY 3,990.00 |
