CYBC1 (NM_001100408) Human Untagged Clone
CAT#: SC316668
C17orf62 (untagged)-Human chromosome 17 open reading frame 62 (C17orf62), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C17orf62; CGD5; Eros |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316668 representing NM_001100408.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTACCTGCAGGTGGAGACCCGCACCAGCTCCCGCCTCCATCTGAAGAGGGCTCCAGGCATCCGGTCC TGGTCCCTGCTGGTTGATAGCCTGGGCTGGAAGCTCTTCTACGTCACAGGCTGCCTGTTTGTGGCTGTG CAGAACTTGGAGGACTGGGAGGAAGCCATCTTCGACAAGAGCACAGGGAAGGTTGTTTTGAAGACGTTC AGCCTCTACAAGAAGCTGCTGACTCTTTTCAGAGCTGGCCACGACCAGGTGGTGGTCCTGCTCCATGAT GTCCGTGATGTGAGCGTGGAGGAGGAGAAGGTCCGGTACTTCGGGAAAGGCTACATGGTGGTGCTCCGG CTTGCGACGGGCTTCTCCCACCCCCTCACGCAGAGTGCAGTCATGGGCCACCGCAGTGATGTGGAAGCC ATCGCCAAGCTCATCACCAGCTTCCTGGAGCTGCACTGCCTTGAGAGCCCCACAGAGCTGTCTCAGAGC AGCGACAGTGAGGCCGGTGACCCTGCAAGCCAGAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001100408 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001100408.2 |
RefSeq Size | 2125 bp |
RefSeq ORF | 522 bp |
Locus ID | 79415 |
UniProt ID | Q9BQA9 |
Protein Families | Transmembrane |
MW | 19.4 kDa |
Gene Summary | Necessary for a stable expression of the CYBA and CYBB subunits of the cytochrome b-245 hetrodimer. Controls the phagocyte respiratory burst and is essential for innate immunity.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1. The resulting protein (isoform b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212730 | C17orf62 (Myc-DDK-tagged)-Human chromosome 17 open reading frame 62 (C17orf62), transcript variant 3 |
CNY 2,400.00 |
|
RC212730L3 | Lenti ORF clone of Human chromosome 17 open reading frame 62 (C17orf62), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212730L4 | Lenti ORF clone of Human chromosome 17 open reading frame 62 (C17orf62), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG212730 | C17orf62 (tGFP-tagged) - Human chromosome 17 open reading frame 62 (C17orf62), transcript variant 3 |
CNY 4,370.00 |