United States
Germany
Japan
United Kingdom
China
POLR2J2 (POLR2J3) (NM_001097615) Human Untagged Clone
CAT＃: SC316107
POLR2J3 (untagged)-Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | POLR2J2; RPB11b1; RPB11b2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316107 representing NM_001097615.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGATCACCATTAACAAGGAC ACCAAGGTACCCAATGCCTGTTTATTCACCATCAACAAAGAAGACCACACACTGGGAAACATCATTAAA TCACAACTCCTAAAAGACCCGCAAGTGCTATTTGCTGGCTACAAAGTCCCCCACCCCTTGGAGCACAAG ATCATCATCCGAGTGCAGACCACGCCGGACTACAGCCCCCAGGAAGCCTTTACCAACGCCATCACCGAC CTCATCAGTGAGCTGTCCCTGCTGGAGGAGCGCTTCCGGACGTGCCTGCTTCCCCTTCGCCTTCTGCCG TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001097615 |
| Insert Size | 348 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001097615.2 |
| RefSeq Size | 1680 bp |
| RefSeq ORF | 348 bp |
| Locus ID | 548644 |
| UniProt ID | Q9GZM3 |
| Protein Pathways | Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
| MW | 13.1 kDa |
| Gene Summary | This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD). Consequently, it is not known if this locus expresses a protein or proteins in vivo. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220730 | POLR2J3 (Myc-DDK-tagged)-Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3) |
CNY 1,200.00 |
|
| RC220730L3 | Lenti ORF clone of Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220730L4 | Lenti ORF clone of Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3), mGFP tagged |
CNY 5,890.00 |
|
| RG220730 | POLR2J3 (tGFP-tagged) - Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3) |
CNY 4,370.00 |
其它POLR2J3产品
