RBFOX2 (NM_001082577) Human Untagged Clone

CAT#: SC315996

RBFOX2 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 4



  "NM_001082577" in other vectors (4)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RBM9 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ106I20.3; Fox-2; FOX2; fxh; HNRBP2; HRNBP2; RBM9; RTA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315996 representing NM_001082577.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAAAAAGAAAATGGTAACTCAGGGTAACCAGGAGCCGACAACAACTCCTGACGCAATGGTTCAG
CCTTTTACTACCATCCCATTTCCACCACCTCCGCAGAATGGAATTCCCACAGAGTATGGGGTGCCACAC
ACTCAAGACTATGCCGGCCAGACCGGTGAGCATAACCTGACACTCTACGGAAGTACGCAAGCCCACGGG
GAGCAGAGCAGCAACTCACCCAGCACACAAAATGGATCTCTTACGACAGAAGGTGGAGCACAGACAGAC
GGCCAGCAGTCACAGACACAAAGTAGTGAAAATTCAGAGAGTAAATCTACCCCGAAACGGCTGCATGTC
TCTAATATTCCTTTCCGCTTCCGGGACCCTGACCTCCGGCAGATGTTTGGGCAGTTTGGCAAAATCCTA
GATGTAGAAATAATCTTTAATGAACGTGGCTCTAAGGGATTCGGGTTCGTAACTTTCGAGAATAGTGCT
GATGCAGACAGGGCCAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAGGTGAATAAT
GCTACAGCACGTGTAATGACCAATAAGAAGATGGTCACACCATATGCAAATGGTTGGAAATTAAGCCCA
GTAGTTGGAGCTGTATATGGTCCGGAGTTATATGCAGCATCCAGCTTTCAAGCAGATGTGTCCCTAGGC
AATGATGCAGCAGTGCCCCTATCAGGAAGAGGGGGTATCAACACTTACATTCCTTTAATCAGTCTCCCT
TTAGTTCCTGGCTTCCCTTACCCTACTGCAGCCACCACGGCAGCCGCTTTCAGAGGAGCCCATTTGAGG
GGCAGAGGGCGGACAGTATATGGTGCAGTCCGAGCGGTACCTCCAACAGCCATCCCCGCCTATCCAGGG
GTGGATATGCAGCCTACAGATATGCACAGCCTGCTACTGCAACCGCAGCCACCGCTGCTGCAGCCGCTG
CAGCCGCTTACAGTGACGGTTATGGCAGGGTGTACACAGCCGACCCCTACCATGCCCTTGCCCCTGCCG
CTAGCTATGGAGTTGGCGCTGTGGCGAGTTTATACCGAGGTGGCTACAGCCGATTTGCCCCCTACTGAA
GTGACGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001082577
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001082577.1
RefSeq Size 6957 bp
RefSeq ORF 1113 bp
Locus ID 23543
UniProt ID O43251
Protein Families Druggable Genome, Transcription Factors
MW 39.8 kDa
Gene Summary This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks an alternate exon in the 3' coding region that results in a frameshift, compared to variant 1. The resulting protein (isoform 4) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...