NRXN3 (NM_138970) Human Untagged Clone

CAT#: SC313436

NRXN3 (untagged)-Human neurexin 3 (NRXN3), transcript variant 2



  "NM_138970" in other vectors (6)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NRXN3 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C14orf60
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313436 representing NM_138970.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACCTGAGAATCCACGCGAGACGGAGCCCTCCTCGCCGGCCGGCCTGGACGCTTGGGATCTGGTTC
CTGTTCTGGGGATGTATCGTCAGCTCTGTATGGAGTTCTTCTAATGTAGCTTCCTCCTCCTCCACCTCT
TCCTCGCCGGGGTCTCACTCTCAGCACGAGCACCATTTCCATGGCAGCAAGCATCACTCAGTGCCTATT
TCTATCTATCGTTCCCCTGTTTCCCTTCGAGGAGGACACGCTGGCGCTACGTACATCTTTGGGAAAAGT
GGTGGGCTTATCCTCTACACCTGGCCAGCCAATGACAGGCCCAGCACGCGGTCTGACCGCCTTGCCGTG
GGCTTCAGCACCACTGTGAAGGATGGCATCTTGGTCCGCATCGACAGTGCTCCAGGACTTGGTGACTTC
CTCCAGCTTCACATAGAACAGGGGAAAATTGGAGTTGTCTTCAACATTGGCACAGTTGACATCTCCATC
AAAGAGGAGAGAACCCCTGTAAATGACGGCAAATACCATGTGGTACGCTTCACCAGGAACGGCGGCAAC
GCCACCCTGCAGGTGGACAACTGGCCAGTGAATGAACATTATCCTACAGGCCGGCAGTTAACCATCTTC
AACACTCAGGCGCAAATAGCCATTGGTGGAAAGGACAAAGGACGCCTCTTCCAAGGCCAACTCTCTGGG
CTCTATTATGATGGTTTGAAAGTACTGAACATGGCGGCTGAGAACAACCCCAATATTAAAATCAATGGA
AGTGTTCGGCTGGTTGGAGAAGTCCCATCAATTTTGGGAACAACACAGACGACCTCCATGCCACCAGAA
ATGTCTACTACTGTCATGGAAACCACTACTACAATGGCGACTACCACAACCCGTAAGAATCGCTCTACA
GCCAGCATTCAGCCAACATCAGATGATCTTGTTTCATCTGCTGAATGTTCAAGTGATGATGAAGACTTT
GTTGAATGTGAGCCGAGTACAGGTAGGTCAGCAAACCCCACGGAGCCGGGAATCAGACGGGTTCCGGGG
GCCTCAGAGGTGATCCGGGAGTCGAGCAGCACAACAGGGATGGTCGTCGGCATTGTGGCTGCTGCCGCC
CTCTGCATCTTGATCCTCCTGTACGCCATGTACAAGTACAGGAACAGGGACGAGGGGTCCTATCAAGTG
GACGAGACGCGGAACTACATCAGCAACTCCGCCCAGAGCAACGGCACGCTCATGAAGGAGAAGCAGCAG
AGCTCGAAGAGCGGCCACAAGAAACAGAAAAACAAGGACAGGGAGTATTACGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_138970
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138970.4
RefSeq Size 8578 bp
RefSeq ORF 1299 bp
Locus ID 9369
UniProt ID Q9HDB5
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 47.3 kDa
Gene Summary This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants and protein isoforms for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. Genetic variation at this locus has been associated with a range of behavioral phenotypes, including alcohol dependence and autism spectrum disorder. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and contains multiple differences in the coding region, including the lack of multiple 5' exons, compared to variant 1. It initiates translation at an alternate start codon. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. This variant encodes a beta isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...