CHRFAM7A (NM_139320) Human Untagged Clone
CAT#: SC313352
CHRFAM7A (untagged)-Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHRNA7; CHRNA7-DR1; D-10; NACHRA7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC313352 representing NM_139320.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAAAAATATTGCATCTACCAGCATTTTCAGTTCCAATTGCTAATCCAGCATTTGTGGATAGCTGCA AACTGCGATATTGCTGATGAGCGCTTTGACGCCACATTCCACACTAACGTGTTGGTGAATTCTTCTGGG CATTGCCAGTACCTGCCTCCAGGCATATTCAAGAGTTCCTGCTACATCGATGTACGCTGGTTTCCCTTT GATGTGCAGCACTGCAAACTGAAGTTTGGGTCCTGGTCTTACGGAGGCTGGTCCTTGGATCTGCAGATG CAGGAGGCAGATATCAGTGGCTATATCCCCAATGGAGAATGGGACCTAGTGGGAATCCCCGGCAAGAGG AGTGAAAGGTTCTATGAGTGCTGCAAAGAGCCCTACCCTGATGTCACCTTCACAGTGACCATGCGCCGC AGGACGCTCTACTATGGCCTCAACCTGCTGATCCCCTGTGTGCTCATCTCCGCCCTCGCCCTGCTGGTG TTCCTGCTTCCTGCAGATTCCGGGGAGAAGATTTCCCTGGGGATAACAGTCTTACTCTCTCTTACCGTC TTCATGCTGCTCGTGGCTGAGATCATGCCCGCAACATCCGATTCGGTACCATTGATAGCCCAGTACTTC GCCAGCACCATGATCATCGTGGGCCTCTCGGTGGTGGTGACGGTGATCGTGCTGCAGTACCACCACCAC GACCCCGACGGGGGCAAGATGCCCAAGTGGACCAGAGTCATCCTTCTGAACTGGTGCGCGTGGTTCCTG CGAATGAAGAGGCCCGGGGAGGACAAGGTGCGCCCGGCCTGCCAGCACAAGCAGCGGCGCTGCAGCCTG GCCAGTGTGGAGATGAGTGCCGTGGCGCCGCCGCCCGCCAGCAACGGGAACCTGCTGTACATCGGCTTC CGCGGCCTGGACGGCGTGCACTGTGTCCCGACCCCCGACTCTGGGGTAGTGTGTGGCCGCATGGCCTGC TCCCCCACGCACGATGAGCACCTCCTGCACGGCGGGCAACCCCCCGAGGGGGACCCGGACTTGGCCAAG ATCCTGGAGGAGGTCCGCTACATTGCCAACCGCTTCCGCTGCCAGGACGAAAGCGAGGCGGTCTGCAGC GAGTGGAAGTTCGCCGCCTGTGTGGTGGACCGCCTGTGCCTCATGGCCTTCTCGGTCTTCACCATCATC TGCACCATCGGCATCCTGATGTCGGCTCCCAACTTCGTGGAGGCCGTGTCCAAAGACTTTGCGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_139320 |
Insert Size | 1239 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_139320.1 |
RefSeq Size | 2858 bp |
RefSeq ORF | 1239 bp |
Locus ID | 89832 |
UniProt ID | Q494W8 |
Domains | Neur_chan_memb, Neur_chan_LBD |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
MW | 46.2 kDa |
Gene Summary | The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The family member CHRNA7, which is located on chromosome 15 in a region associated with several neuropsychiatric disorders, is partially duplicated and forms a hybrid with a novel gene from the family with sequence similarity 7 (FAM7A). Alternative splicing has been observed, and two variants exist, for this hybrid gene. The N-terminally truncated products predicted by the largest open reading frames for each variant would lack the majority of the neurotransmitter-gated ion-channel ligand binding domain but retain the transmembrane region that forms the ion channel. Although current evidence supports transcription of this hybrid gene, translation of the nicotinic acetylcholine receptor-like protein-encoding open reading frames has not been confirmed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the full-length variant and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215588 | CHRFAM7A (Myc-DDK-tagged)-Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1 |
CNY 3,656.00 |
|
RC215588L1 | Lenti ORF clone of Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215588L2 | Lenti ORF clone of Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC215588L3 | Lenti ORF clone of Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215588L4 | Lenti ORF clone of Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG215588 | CHRFAM7A (tGFP-tagged) - Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1 |
CNY 4,370.00 |
其它CHRFAM7A产品