CHRFAM7A (NM_139320) Human Untagged Clone

CAT#: SC313352

CHRFAM7A (untagged)-Human CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion (CHRFAM7A), transcript variant 1



  "NM_139320" in other vectors (6)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CHRFAM7A Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHRNA7; CHRNA7-DR1; D-10; NACHRA7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313352 representing NM_139320.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAAAAATATTGCATCTACCAGCATTTTCAGTTCCAATTGCTAATCCAGCATTTGTGGATAGCTGCA
AACTGCGATATTGCTGATGAGCGCTTTGACGCCACATTCCACACTAACGTGTTGGTGAATTCTTCTGGG
CATTGCCAGTACCTGCCTCCAGGCATATTCAAGAGTTCCTGCTACATCGATGTACGCTGGTTTCCCTTT
GATGTGCAGCACTGCAAACTGAAGTTTGGGTCCTGGTCTTACGGAGGCTGGTCCTTGGATCTGCAGATG
CAGGAGGCAGATATCAGTGGCTATATCCCCAATGGAGAATGGGACCTAGTGGGAATCCCCGGCAAGAGG
AGTGAAAGGTTCTATGAGTGCTGCAAAGAGCCCTACCCTGATGTCACCTTCACAGTGACCATGCGCCGC
AGGACGCTCTACTATGGCCTCAACCTGCTGATCCCCTGTGTGCTCATCTCCGCCCTCGCCCTGCTGGTG
TTCCTGCTTCCTGCAGATTCCGGGGAGAAGATTTCCCTGGGGATAACAGTCTTACTCTCTCTTACCGTC
TTCATGCTGCTCGTGGCTGAGATCATGCCCGCAACATCCGATTCGGTACCATTGATAGCCCAGTACTTC
GCCAGCACCATGATCATCGTGGGCCTCTCGGTGGTGGTGACGGTGATCGTGCTGCAGTACCACCACCAC
GACCCCGACGGGGGCAAGATGCCCAAGTGGACCAGAGTCATCCTTCTGAACTGGTGCGCGTGGTTCCTG
CGAATGAAGAGGCCCGGGGAGGACAAGGTGCGCCCGGCCTGCCAGCACAAGCAGCGGCGCTGCAGCCTG
GCCAGTGTGGAGATGAGTGCCGTGGCGCCGCCGCCCGCCAGCAACGGGAACCTGCTGTACATCGGCTTC
CGCGGCCTGGACGGCGTGCACTGTGTCCCGACCCCCGACTCTGGGGTAGTGTGTGGCCGCATGGCCTGC
TCCCCCACGCACGATGAGCACCTCCTGCACGGCGGGCAACCCCCCGAGGGGGACCCGGACTTGGCCAAG
ATCCTGGAGGAGGTCCGCTACATTGCCAACCGCTTCCGCTGCCAGGACGAAAGCGAGGCGGTCTGCAGC
GAGTGGAAGTTCGCCGCCTGTGTGGTGGACCGCCTGTGCCTCATGGCCTTCTCGGTCTTCACCATCATC
TGCACCATCGGCATCCTGATGTCGGCTCCCAACTTCGTGGAGGCCGTGTCCAAAGACTTTGCGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_139320
Insert Size 1239 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_139320.1
RefSeq Size 2858 bp
RefSeq ORF 1239 bp
Locus ID 89832
UniProt ID Q494W8
Domains Neur_chan_memb, Neur_chan_LBD
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
MW 46.2 kDa
Gene Summary The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The family member CHRNA7, which is located on chromosome 15 in a region associated with several neuropsychiatric disorders, is partially duplicated and forms a hybrid with a novel gene from the family with sequence similarity 7 (FAM7A). Alternative splicing has been observed, and two variants exist, for this hybrid gene. The N-terminally truncated products predicted by the largest open reading frames for each variant would lack the majority of the neurotransmitter-gated ion-channel ligand binding domain but retain the transmembrane region that forms the ion channel. Although current evidence supports transcription of this hybrid gene, translation of the nicotinic acetylcholine receptor-like protein-encoding open reading frames has not been confirmed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is the full-length variant and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...