KCTD7 (NM_153033) Human Untagged Clone

CAT#: SC312818

KCTD7 (untagged)-Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1



  "NM_153033" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KCTD7 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLN14; EPM3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312818 representing NM_153033.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGTAGTCACGGGGCGGGAGCCAGACAGCCGTCGTCAGGACGGTGCCATGTCCAGCTCTGACGCC
GAAGACGACTTTCTGGAGCCGGCCACGCCGACGGCCACGCAGGCGGGGCACGCGCTGCCCCTGCTGCCA
CAGGAGTTTCCTGAGGTTGTTCCCCTTAACATCGGAGGGGCTCACTTCACTACACGCCTGTCCACACTG
CGGTGCTACGAAGACACCATGTTGGCAGCCATGTTCAGTGGGCGGCACTACATCCCCACGGACTCCGAG
GGCCGGTACTTCATCGACCGAGATGGCACACACTTTGGAGATGTGCTGAATTTCCTGCGCTCAGGGGAC
CTCCCACCCAGGGAGCGTGTTCGAGCTGTGTACAAAGAGGCCCAGTACTATGCCATCGGGCCCCTCCTG
GAGCAGCTGGAGAACATGCAGCCACTGAAGGGCGAGAAGGTGCGCCAAGCGTTTCTGGGACTCATGCCC
TATTACAAAGACCACTTGGAGCGGATTGTGGAGATCGCCCGGCTGCGTGCGGTCCAGCGGAAGGCCCGC
TTTGCCAAGCTCAAGGTCTGTGTCTTCAAGGAGGAGATGCCCATCACCCCCTATGAGTGTCCGCTCCTC
AACTCCCTGCGATTTGAGCGGAGTGAGAGTGACGGGCAGCTTTTTGAGCACCACTGTGAAGTGGATGTG
TCTTTTGGGCCCTGGGAGGCTGTGGCTGATGTTTATGACCTGCTGCACTGCCTGGTCACGGACCTCTCG
GCCCAGGGTCTCACCGTGGACCACCAGTGCATCGGGGTGTGTGACAAGCACCTCGTGAACCACTACTAC
TGCAAGCGCCCCATCTATGAGTTCAAGATCACATGGTGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_153033
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153033.4
RefSeq Size 5051 bp
RefSeq ORF 870 bp
Locus ID 154881
UniProt ID Q96MP8
Domains BTB, K_tetra
Protein Families Ion Channels: Other
MW 33.1 kDa
Gene Summary This gene encodes a member of the potassium channel tetramerization domain-containing protein family. Family members are identified on a structural basis and contain an amino-terminal domain similar to the T1 domain present in the voltage-gated potassium channel. Mutations in this gene have been associated with progressive myoclonic epilepsy-3. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...