SCD5 (NM_024906) Human Untagged Clone

CAT#: SC312669

SCD5 (untagged)-Human stearoyl-CoA desaturase 5 (SCD5), transcript variant 2



  "NM_024906" in other vectors (4)

CNY 2,640.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
SCD5 Antibody - C-terminal region
    • 50 ug

CNY 5,070.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACOD4; FADS4; HSCD5; SCD2; SCD4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312669 representing NM_024906.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAGGCCCGGCCACCGACGCGGGGAAGATCCCTTTCTGCGACGCCAAGGAAGAAATCCGTGCCGGG
CTCGAAAGCTCTGAGGGCGGCGGCGGCCCGGAGAGGCCAGGCGCGCGCGGGCAGCGGCAGAACATCGTC
TGGAGGAATGTCGTCCTGATGAGCTTGCTCCACTTGGGGGCCGTGTACTCCCTGGTGCTCATCCCCAAA
GCCAAGCCACTCACTCTGCTCTGGGCCTACTTCTGCTTCCTCCTGGCCGCTCTGGGTGTGACAGCTGGT
GCCCATCGCTTGTGGAGCCACAGGTCCTACCGGGCCAAGCTGCCTCTGAGGATATTTCTGGCTGTCGCC
AACTCCATGGCTTTCCAGAATGACATCTTCGAGTGGTCCAGGGACCACCGAGCCCACCACAAGTACTCA
GAGACGGATGCTGACCCCCACAATGCCCGCCGGGGCTTCTTCTTCTCCCATATTGGGTGGCTGTTTGTT
CGCAAGCATCGAGATGTTATTGAGAAGGGGAGAAAGCTTGACGTCACTGACCTGCTTGCTGATCCTGTG
GTCCGGATCCAGAGAAATACACAGCACATCCAGAAAGAAGGAAGAGCTCTCAATCAAGAGGCAGCGTGT
GAGATGCTTCGTGAATGGCATCAAGGGCATATATTGAAAGTCACCCTTCCCGGATTACACATTTTAGCT
TTGTTACATACTCATTGTAACCACTCCGAAAAGTGCTGCTTGATGCTGCGTGCTCTTTCTGTGTCCCTG
GAGGTATTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_024906
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024906.2
RefSeq Size 2080 bp
RefSeq ORF 771 bp
Locus ID 79966
UniProt ID Q86SK9
Domains FA_desaturase
Protein Families Transmembrane
Protein Pathways Biosynthesis of unsaturated fatty acids, PPAR signaling pathway
MW 29 kDa
Gene Summary Stearoyl-CoA desaturase (SCD; EC 1.14.99.5) is an integral membrane protein of the endoplasmic reticulum that catalyzes the formation of monounsaturated fatty acids from saturated fatty acids. SCD may be a key regulator of energy metabolism with a role in obesity and dislipidemia. Four SCD isoforms, Scd1 through Scd4, have been identified in mouse. In contrast, only 2 SCD isoforms, SCD1 (MIM 604031) and SCD5, have been identified in human. SCD1 shares about 85% amino acid identity with all 4 mouse SCD isoforms, as well as with rat Scd1 and Scd2. In contrast, SCD5 shares limited homology with the rodent SCDs and appears to be unique to primates (Wang et al., 2005 [PubMed 15907797]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) has multiple differences in the 3' coding region, compared to variant 1, which result in a protein (isoform B) with a shorter and distinct C-terminus, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...