AP1S3 (BC021898) Human Untagged Clone

CAT#: SC311671

AP1S3 (untagged)-Human adaptor-related protein complex 1, sigma 3 subunit (cDNA clone MGC:17284 IMAGE:4340257), complete cds



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


AP1S3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms adaptor-related protein complex 1, sigma 3 subunit; sigma 1C adaptin
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC021898, the custom clone sequence may differ by one or more nucleotides
ATGATACATTTCATATTGCTCTTCAGTCGACAAGGGAAATTACGGCTACAGAAATGGTAC
ATCACTCTCCCTGATAAAGAGAGGAAGAAGATCACCCGGGAAATTGTTCAGATTATTCTC
TCCCGTGGTCACAGGACAAGCAGTTTTGTTGACTGGAAGGAGCTAAAACTTGTTTATAAA
AGGTATGCTAGTTTATATTTTTGCTGTGCAATAGAAAATCAGGACAATGAGCTCTTGACG
CTAGAGATTGTGCATCGTTACGTGGAGCTGCTGGACAAATATTTTGGAAATACTTGGCCT
TTTGCAAGAGCC
Restriction Sites Please inquire     
ACCN BC021898
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021898.1, AAH21898.1
RefSeq Size 2326 bp
RefSeq ORF 315 bp
Locus ID 130340
Domains Clat_adaptor_s
Protein Pathways Lysosome
Gene Summary This gene encodes a member of the adaptor-related protein complex 1, sigma subunit genes. The encoded protein is a component of adaptor protein complex 1 (AP-1), one of the AP complexes involved in claathrin-mediated vesicular transport from the Golgi or endosomes. Disruption of the pathway for display of HIV-1 antigens, which prevents recognition of the virus by cytotoxic T cells, has been shown to involve the AP-1 complex (PMID: 15569716). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...