ethanolamine kinase (ETNK1) (NM_001039481) Human Untagged Clone

CAT#: SC310888

ETNK1 (untagged)-Human ethanolamine kinase 1 (ETNK1), transcript variant 2



  "NM_001039481" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EKI; EKI 1; EKI1; Nbla10396
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310888 representing NM_001039481.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCTGCGGCCGCCCGCGGTCCAGCTCCGACAACAGGAATTTTCTCCGAGAGCGGGCCGGGCTCAGT
TCAGCTGCTGTCCAGACCCGGATCGGCAACAGTGCCGCCTCCAGACGTTCTCCTGCCGCTCGCCCGCCC
GTCCCAGCGCCCCCAGCCCTCCCGCGAGGGCGCCCCGGGACGGAAGGATCCACCAGTCTGTCGGCGCCC
GCCGTTCTCGTGGTCGCCGTCGCCGTCGTCGTGGTGGTAGTCTCCGCCGTCGCCTGGGCCATGGCCAAT
TACATCCACGTCCCTCCCGGCTCCCCGGAGGTGCCCAAGCTGAACGTCACCGTTCAGGATCAGGAGGAG
CATCGCTGCCGGGAGGGGGCCCTGAGCCTCCTGCAACACCTGCGGCCTCACTGGGACCCCCAGGAGGTG
ACCCTGCAGCTCTTCACAGATGGAATCACAAATAAACTTATTGGCTGTTACGTGGGAAACACCATGGAG
GATGTAGTCCTGGTGAGAATTTATGGCAATAAGACTGAGTTATTAGTCGATCGAGATGAGGAAGTAAAG
AGTTTTCGAGTGTTGCAGGCTCATGGGTGTGCACCACAACTCTACTGTACCTTCAATAATGGACTATGC
TATGAATTTATACAAGGAGAAGCACTGGATCCAAAGCATGTCTGCAACCCAGCCATTTTCAGTTTATCA
TCGTTGACTCTTTGCAAAGGAAAAACTACAAGATGTTTTGGATTAACCGGCTGCAGAGGGTCAAGGCTT
CTGCTTAGTTTTTTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039481
Insert Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039481.1
RefSeq Size 910 bp
RefSeq ORF 777 bp
Locus ID 55500
UniProt ID Q9HBU6
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glycerophospholipid metabolism, Metabolic pathways
MW 28 kDa
Gene Summary This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) retains the first two exons, uses an alternate third exon, and lacks all other exons, compared to variant 1. The resulting protein (isoform B) is shorter, has a distinct C-terminus, and lacks the putative active site and kinase domain, compared to isoform A. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...