PVRL1 (NECTIN1) (NM_002855) Human Untagged Clone
CAT#: SC310863
PVRL1 (untagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1
CNY 6,168.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD111; CLPED1; ED4; HIgR; HV1S; HVEC; nectin-1; OFC7; PRR; PRR1; PVRL1; PVRR; PVRR1; SK-12 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002855, the custom clone sequence may differ by one or more nucleotides
ATGGCTCGGATGGGGCTTGCGGGCGCCGCTGGACGCTGGTGGGGACTCGCTCTCGGCTTG ACCGCATTCTTCCTCCCAGGCGTCCACTCCCAGGTGGTCCAGGTGAACGACTCCATGTAT GGCTTCATCGGCACAGACGTGGTTCTGCACTGCAGCTTTGCCAACCCGCTTCCCAGCGTG AAGATCACCCAGGTCACATGGCAGAAGTCCACCAATGGCTCCAAGCAGAACGTGGCCATC TACAACCCATCCATGGGCGTGTCCGTGCTGGCTCCCTACCGCGAGCGTGTGGAATTCCTG CGGCCCTCCTTCACCGATGGCACTATCCGCCTCTCCCGCCTGGAGCTGGAGGATGAGGGT GTCTACATCTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTCAATCTC ACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAG AAGGGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCC AGTGTGGTATCCTGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAAC CCCAATGGCACAGTGACGGTCATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCAC CAGCAGTCCTTGGCCTGCATCGTCAACTACCACATGGACCGCTTCAAGGAAAGCCTCACT CTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGGTTTGATGGCAACTGGTACCTG CAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTAACCCCCCAGCCACTGAGTAC CACTGGACCACGCTAAATGGCTCTCTCCCCAAGGGTGTGGAGGCCCAGAACAGAACCCTC TTCTTCAAGGGACCCATCAACTACAGCCTGGCAGGGACCTACATCTGTGAGGCCACCAAC CCCATCGGTACACGCTCAGGCCAGGTGGAGGTCAATATCACAGAATTCCCCTACACCCCG TCTCCTCCCGAACATGGGCGGCGCGCCGGGCCGGTGCCCACGGCCATCATTGGGGGCGTG GCGGGGAGCATCCTGCTGGTGTTGATTGTGGTCGGCGGGATCGTGGTCGCCCTGCGTCGG CGCCGGCACACCTTCAAGGGTGACTACAGCACCAAGAAGCACGTGTATGGCAACGGCTAC AGCAAGGCAGGCATCCCCCAGCACCACCCACCAATGGCACAGAACCTGCAGTACCCCGAC GACTCAGACGACGAGAAGAAGGCCGGCCCACTGGGTGGAAGCAGCTATGAGGAGGAGGAG GAGGAGGAGGAGGGCGGTGGAGGGGGCGAGCGCAAGGTGGGCGGCCCCCACCCCAAATAT GACGAGGACGCCAAGCGGCCCTACTTCACCGTGGATGAGGCCGAGGCCCGTCAGGACGGC TACGGGGACCGGACTCTGGGCTACCAGTACGACCCTGAGCAGCTGGACTTGGCTGAGAAC ATGGTTTCTCAGAACGACGGGTCTTTCATTTCCAAGAAGGAGTGGTACGTGTAG |
Restriction Sites | Please inquire |
ACCN | NM_002855 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002855.4, NP_002846.3 |
RefSeq Size | 5493 bp |
RefSeq ORF | 1554 bp |
Locus ID | 5818 |
UniProt ID | Q15223 |
Domains | ig, IGv, IGc2, IG |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
Protein Pathways | Adherens junction, Cell adhesion molecules (CAMs) |
Gene Summary | This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1; also known as isoform Delta, alpha, or HveC). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211214 | PVRL1 (Myc-DDK-tagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1 |
CNY 5,776.00 |
|
RC211214L1 | Lenti-ORF clone of PVRL1 (Myc-DDK-tagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1 |
CNY 8,176.00 |
|
RC211214L2 | Lenti-ORF clone of PVRL1 (mGFP-tagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1 |
CNY 5,890.00 |
|
RC211214L3 | Lenti-ORF clone of PVRL1 (Myc-DDK-tagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1 |
CNY 5,890.00 |
|
RC211214L4 | Lenti-ORF clone of PVRL1 (mGFP-tagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1 |
CNY 5,890.00 |
|
RG211214 | PVRL1 (tGFP-tagged) - Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 1 |
CNY 7,376.00 |