MCP2 (CCL8) (NM_005623) Human Untagged Clone

CAT#: SC310690

CCL8 (untagged)-Human chemokine (C-C motif) ligand 8 (CCL8)



  "NM_005623" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CCL8 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HC14; MCP-2; MCP2; SCYA8; SCYA10
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005623 edited
CCTTCAGCCTCTGCTCCACAGAGCCTAAGCAAAAGATAGAAACTCACAACTTCCTTGTTT
TGTTATCTGGAAATTATCCCAGGATCTGGTGCTTACTCAGCATATTCAAGGAAGGTCTTA
CTTCATTCTTCCTTGATTGTGACCATGCCCAGGCTCTCTGCTCCCTATAAAAGGCAGGCA
GAGCCACCGAGGAGCAGAGAGGTTGAGAACAACCCAGAAACCTTCACCTCTCATGCTGAA
GCTCACACCCTTGCCCTCCAAGATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCAT
GGCAGCCACTTTCAGCCCTCAGGGACTTGCTCAGCCAGATTCAGTTTCCATTCCAATCAC
CTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAGGCTGGAGAGCTACACAAG
AATCACCAACATCCAATGTCCCAAGGAAGCTGTGATCTTCAAGACCCAACGGGGCAAGGA
GGTCTGTGCTGACCCCAAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAAT
ATTTCAAAATCTGAAGCCATGAGCCTTCATACATGGACTGAGAGTCAGAGCTTGAAGAAA
AGCTTATTTATTTTCCCCAACCTCCCCC
Restriction Sites Please inquire     
ACCN NM_005623
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_005623.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005623.2, NP_005614.2
RefSeq Size 1351 bp
RefSeq ORF 300 bp
Locus ID 6355
UniProt ID P80075
Domains IL8
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway
Gene Summary This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...