United States
Germany
Japan
United Kingdom
China
PP4R4 (PPP4R4) (NM_020958) Human Untagged Clone
CAT＃: SC310683
PPP4R4 (untagged)-Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CFAP14; KIAA1622; PP4R4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310683 representing NM_020958.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCATCCGCCGCCGCCCGCCGCCGCGATGGATTTCAGTCAGAACAGCCTGTTCGGTTACATGGAGGAC CTGCAGGAGCTCACCATCATCGAGAGGCCGGTCCGCCGGAGCCTCAAGACACCGGAAGAAATAGAAAGA TTGACAGTCGATGAAGACCTCAGTGATATTGAAAGGGCTGTTTATCTGCTCAGTGCTGGTCAAGATGTC CAAGGAACAAGTGTGATTGCAAATCTCCCATTTTTGATGCGACAGAATCCCACTGAGACGCTTCGGAGA GTGTTGCCAAAAGTCAGAGTCCATGAGGATGCACACTTATTTATCCAGAGAGTATGGATCTCACATATG TTTGTCCAGAGGGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_020958 |
| Insert Size | 363 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020958.2 |
| RefSeq Size | 923 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 57718 |
| UniProt ID | Q6NUP7 |
| Protein Families | Phosphatase |
| MW | 13.9 kDa |
| Gene Summary | The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1, resulting in a shorter isoform (2) that has a distinct C-terminus lacking HEAT-like repeats. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212907 | PPP4R4 (Myc-DDK-tagged)-Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2 |
CNY 4,792.00 |
|
| RC212907L3 | Lenti ORF clone of Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212907L4 | Lenti ORF clone of Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212907 | PPP4R4 (tGFP-tagged) - Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2 |
CNY 6,392.00 |
