ATP1B4 (NM_012069) Human Untagged Clone

CAT#: SC308949

ATP1B4 (untagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 2



  "NM_012069" in other vectors (4)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ATP1B4 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308949 representing NM_012069.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGAAGGCAACTCCGGTCCAGAAGGGCTCCATCCTTTCCTTACAGTTATCGCTACAGACTCGATGAT
CCGGATGAAGCGAACCAGAACTACTTAGCAGATGAAGAGGAGGAAGCAGAAGAAGAGGCTCGGGTGACG
GTGGTGCCCAAATCGGAGGAGGAGGAAGAAGAGGAGGAGAAAGAAGAGGAGGAAGAGGAGGAAAAGGAG
GAGGAAGAGGGTCAAGGTCAGCCAACAGGCAATGCCTGGTGGCAGAAATTGCAGATCATGAGTGAATAC
CTGTGGGATCCAGAGAGAAGGATGTTTCTGGCCCGAACAGGCCTGATCTTACTCATTTACTTCTTCTTC
TATGCCTCCTTGGCTGCTGTGATCACCCTCTGCATGTACACACTATTTCTGACCATCAGTCCCTATATA
CCAACCTTCACGGAGCGGGTAAAGCCTCCTGGAGTTATGATCAGACCCTTCGCCCATAGCCTTAACTTC
AACTTCAACGTTTCTGAACCCGACACTTGGCAGCATTATGTGATTAGCCTAAATGGCTTTCTCCAGGGT
TATAATGACAGTCTTCAAGAGGAAATGAATGTAGATTGTCCCCCGGGGCAGTACTTCATCCAAGATGGC
AATGAGGATGAGGACAAGAAGGCCTGCCAATTTAAGCGCTCCTTCCTAAAGAACTGCTCTGGTCTGGAG
GACCCAACTTTTGGATACTCTACTGGACAGCCCTGCATCCTTCTAAAGATGAACCGGATTGTAGGCTTT
CGTCCTGAGCTTGGAGATCCTGTGAAGGTTTCCTGCAAAGTTCAGAGAGGTGATGAAAATGACATCCGA
TCCATCAGTTACTACCCAGAGTCGGCTTCTTTTGACCTCCGCTACTACCCTTACTACGGCAAACTGACT
CACGTTAACTACACATCCCCCTTGGTGGCAATGCACTTTACAGACGTGGTGAAGAACCAAGCAGTGCCT
GTGCAGTGCCAACTGAAGGGCAAAGGCGTCATAAATGATGTCATCAATGATCGTTTTGTGGGCAGGGTA
ATCTTTACCCTGAACATAGAAACTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_012069
Insert Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012069.4
RefSeq Size 4761 bp
RefSeq ORF 1062 bp
Locus ID 23439
UniProt ID Q9UN42
Protein Families Transmembrane
Protein Pathways Cardiac muscle contraction
MW 41.1 kDa
Gene Summary This gene has been found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na,K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (2) uses an alternate in-frame splice site that deletes 12 nts in the 5' coding region, compared to variant 1. This variant encodes isoform B which is 4 aa shorter than isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...