Activin A Receptor Type IB (ACVR1B) (NM_020327) Human Untagged Clone
CAT#: SC308835
ACVR1B (untagged)-Human activin A receptor, type IB (ACVR1B), transcript variant 2
CNY 7,700.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACTRIB; ACVRLK4; ALK4; SKR2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_020327, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGTCGGCCGGAGCCTCCTCCTTCTTCCCCCTTGTTGTCCTCCTGCTCGCCGGC AGCGGCGGGTCCGGGCCCCGGGGGGTCCAGGCTCTGCTGTGTGCGTGCACCAGCTGCCTC CAGGCCAACTACACGTGTGAGACAGATGGGGCCTGCATGGTTTCCATTTTCAATCTGGAT GGGATGGAGCACCATGTGCGCACCTGCATCCCCAAAGTGGAGCTGGTCCCTGCCGGGAAG CCCTTCTACTGCCTGAGCTCGGAGGACCTGCGCAACACCCACTGCTGCTACACTGACTAC TGCAACAGGATCGACTTGAGGGTGCCCAGTGGTCACCTCAAGGAGCCTGAGCACCCGTCC ATGTGGGGCCCGGTGGAGCTGGTAGGCATCATCGCCGGCCCGGTGTTCCTCCTGTTCCTC ATCATCATCATTGTTTTCCTTGTCATTAACTATCATCAGCGTGTCTATCACAACCGCCAG AGACTGGACATGGAAGATCCCTCATGTGAGATGTGTCTCTCCAAAGACAAGACGCTCCAG GATCTTGTCTACGATCTCTCCACCTCAGGGTCTGGCTCAGGGTTACCCCTCTTTGTCCAG CGCACAGTGGCCCGAACCATCGTTTTACAAGAGATTATTGGCAAGGGTCGGTTTGGGGAA GTATGGCGGGGCCGCTGGAGGGGTGGTGATGTGGCTGTGAAAATATTCTCTTCTCGTGAA GAACGGTCTTGGTTCAGGGAAGCAGAGATATACCAGACGGTCATGCTGCGCCATGAAAAC ATCCTTGGATTTATTGCTGCTGACAATAAAGATAATGGCACCTGGACACAGCTGTGGCTT GTTTCTGACTATCATGAGCACGGGTCCCTGTTTGATTATCTGAACCGGTACACAGTGACA ATTGAGGGGATGATTAAGCTGGCCTTGTCTGCTGCTAGTGGGCTGGCACACCTGCACATG GAGATCGTGGGCACCCAAGGGAAGCCTGGAATTGCTCATCGAGACTTAAAGTCAAAGAAC ATTCTGGTGAAGAAAAATGGCATGTGTGCCATAGCAGACCTGGGCCTGGCTGTCCGTCAT GATGCAGTCACTGACACCATTGACATTGCCCCGAATCAGAGGGTGGGGACCAAACGATAC ATGGCCCCTGAAGTACTTGATGAAACCATTAATATGAAACACTTTGACTCCTTTAAATGT GCTGATATTTATGCCCTCGGGCTTGTATATTGGGAGATTGCTCGAAGATGCAATTCTGGA GGAGTCCATGAAGAATATCAGCTGCCATATTACGACTTAGTGCCCTCTGACCCTTCCATT GAGGAAATGCGAAAGGTTGTATGTGATCAGAAGCTGCGTCCCAACATCCCCAACTGGTGG CAGAGTTATGAGGTAAGAAGCTGGCCTCCTGCTGCTTTCCCATCAGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_020327 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_020327.2, NP_064732.2 |
RefSeq Size | 1783 bp |
RefSeq ORF | 1431 bp |
Locus ID | 91 |
UniProt ID | P36896 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Cytokine-cytokine receptor interaction, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway |
Gene Summary | This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222334 | ACVR1B (Myc-DDK-tagged)-Human activin A receptor, type IB (ACVR1B), transcript variant 2 |
CNY 4,750.00 |
|
RC222334L3 | Lenti-ORF clone of ACVR1B (Myc-DDK-tagged)-Human activin A receptor, type IB (ACVR1B), transcript variant 2 |
CNY 6,650.00 |
|
RC222334L4 | Lenti-ORF clone of ACVR1B (mGFP-tagged)-Human activin A receptor, type IB (ACVR1B), transcript variant 2 |
CNY 6,650.00 |
|
RG222334 | ACVR1B (tGFP-tagged) - Human activin A receptor, type IB (ACVR1B), transcript variant 2 |
CNY 5,230.00 |