CA12 (NM_206925) Human Untagged Clone

CAT#: SC308325

CA12 (untagged)-Human carbonic anhydrase XII (CA12), transcript variant 2



  "NM_206925" in other vectors (5)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CA12 mouse monoclonal antibody, clone OTI2C6 (formerly 2C6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CA-XII; CAXII; HsT18816; T18816
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308325 representing NM_206925.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCCGGCGCAGCCTGCACGCGGCGGCCGTGCTCCTGCTGGTGATCTTAAAGGAACAGCCTTCCAGC
CCGGCCCCAGTGAACGGTTCCAAGTGGACTTATTTTGGTCCTGATGGGGAGAATAGCTGGTCCAAGAAG
TACCCGTCGTGTGGGGGCCTGCTGCAGTCCCCCATAGACCTGCACAGTGACATCCTCCAGTATGACGCC
AGCCTCACGCCCCTCGAGTTCCAAGGCTACAATCTGTCTGCCAACAAGCAGTTTCTCCTGACCAACAAT
GGCCATTCAGTGAAGCTGAACCTGCCCTCGGACATGCACATCCAGGGCCTCCAGTCTCGCTACAGTGCC
ACGCAGCTGCACCTGCACTGGGGGAACCCGAATGACCCGCACGGCTCTGAGCACACCGTCAGCGGACAG
CACTTCGCCGCCGAGCTGCACATTGTCCATTATAACTCAGACCTTTATCCTGACGCCAGCACTGCCAGC
AACAAGTCAGAAGGCCTCGCTGTCCTGGCTGTTCTCATTGAGATGGGCTCCTTCAATCCGTCCTATGAC
AAGATCTTCAGTCACCTTCAACATGTAAAGTACAAAGGCCAGGAAGCATTCGTCCCGGGATTCAACATT
GAAGAGCTGCTTCCGGAGAGGACCGCTGAATATTACCGCTACCGGGGGTCCCTGACCACACCCCCTTGC
AACCCCACTGTGCTCTGGACAGTTTTCCGAAACCCCGTGCAAATTTCCCAGGAGCAGCTGCTGGCTTTG
GAGACAGCCCTGTACTGCACACACATGGACGACCCTTCCCCCAGAGAAATGATCAACAACTTCCGGCAG
GTCCAGAAGTTCGATGAGAGGCTGGTATACACCTCCTTCTCCCAAGGCATCATCCTCTCACTGGCCCTG
GCTGGCATTCTTGGCATCTGTATTGTGGTGGTGGTGTCCATTTGGCTTTTCAGAAGGAAGAGTATCAAA
AAAGGTGATAACAAGGGAGTCATTTACAAGCCAGCCACCAAGATGGAGACTGAGGCCCACGCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_206925
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_206925.2
RefSeq Size 4176 bp
RefSeq ORF 1032 bp
Locus ID 771
UniProt ID O43570
Protein Families Druggable Genome, Transmembrane
Protein Pathways Nitrogen metabolism
MW 38.4 kDa
Gene Summary Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. This gene product is a type I membrane protein that is highly expressed in normal tissues, such as kidney, colon and pancreas, and has been found to be overexpressed in 10% of clear cell renal carcinomas. Three transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...