United States
Germany
Japan
United Kingdom
China
Myoglobin (MB) (NM_203377) Human Untagged Clone
CAT＃: SC308144
MB (untagged)-Human myoglobin (MB), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PVALB |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_203377, the custom clone sequence may differ by one or more nucleotides
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAG GCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTGCTC ACCGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC ATGCCACCAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCA GAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG |
| Restriction Sites | NotI-NotI |
| ACCN | NM_203377 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found two SNPs within the protein associated with this reference, NM_203377.1. These two SNPs don't change amino acid. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_203377.1, NP_976311.1 |
| RefSeq Size | 1170 bp |
| RefSeq ORF | 465 bp |
| Locus ID | 4151 |
| UniProt ID | P02144 |
| Gene Summary | This gene encodes a member of the globin superfamily and is predominantly expressed in skeletal and cardiac muscles. The encoded protein forms a monomeric globular haemoprotein that is primarily responsible for the storage and facilitated transfer of oxygen from the cell membrane to the mitochondria. This protein also plays a role in regulating physiological levels of nitric oxide. Multiple transcript variants encoding distinct isoforms exist for this gene. [provided by RefSeq, May 2020] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213272 | MB (Myc-DDK-tagged)-Human myoglobin (MB), transcript variant 2 |
CNY 1,200.00 |
|
| RC213272L3 | Lenti ORF clone of Human myoglobin (MB), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213272L4 | Lenti ORF clone of Human myoglobin (MB), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG213272 | MB (tGFP-tagged) - Human myoglobin (MB), transcript variant 2 |
CNY 2,800.00 |
其它Myoglobin产品
