WWP2 (NM_199423) Human Untagged Clone
CAT#: SC307968
WWP2 (untagged)-Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3
CNY 5,420.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIP2; WWp2-like |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307968 representing NM_199423.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCATCTGCCAGCTCTAGCCGGGCAGGAGTGGCCCTGCCTTTTGAGAAGTCTCAGCTCACTTTGAAA GTGGTGTCCGCAAAGCCCAAGGTGCATAATCGTCAACCTCGAATTAACTCCTACGTGGAGGTGGCGGTG GATGGACTCCCCAGTGAGACCAAGAAGACTGGGAAGCGCATTGGGAGCTCTGAGCTTCTCTGGAATGAG ATCATCATTTTGAATGTCACGGCACAGAGTCATTTAGATTTAAAGGTCTGGAGCTGCCATACCTTGAGA AATGAACTGCTAGGCACCGCATCTGTCAACCTCTCCAACGTCTTGAAGAACAATGGGGGCAAAATGGAG AACATGCAGCTGACCCTGAACCTGCAGACGGAGAACAAAGGCAGCGTTGTCTCAGGCGGAGAGCTGACA ATTTTCCTGGACGGGCCAACTGTTGATCTGGGAAATGTGCCTAATGGCAGTGCCCTGACAGATGGATCA CAGCTGCCTTCGAGAGACTCCAGTGGAACAGCAGTAGCTCCAGAGAACCGGCACCAGCCCCCCAGCACA AACTGCTTTGGTGGAAGATCCCGGACGCACAGACATTCGGGTGCTTCAGCCAGAACAACCCCAGCAACC GGCGAGCAAAGCCCCGGTGCTCGGAGCCGGCACCGCCAGCCCGTCAAGAACTCAGGCCACAGTGGCTTG GCCAATGGCACAGTGAATGATGAACCCACAACAGCCACTGATCCCGAAGAACCTTCCGTTGTTGGTGTG ACGTCCCCACCTGCTGCACCCTTGAGTGTGACCCCGAATCCCAACACGACTTCTCTCCCTGCCCCAGCC ACACCGGCTGAAGGAGAGGAACCCAGCACTTCGGGTACACAGCAGCTCCCAGCGGCTGCCCAGGCCCCC GACGCTCTGCCTGCTGGATGGGAACAGCGAGAGCTGCCCAACGGACGTGTCTATTATGTTGACCACAAT ACCAAGACCACCACCTGGGAGCGGCCCCTTCCTCCAGGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_199423 |
Insert Size | 1008 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_199423.1 |
RefSeq Size | 2659 bp |
RefSeq ORF | 1008 bp |
Locus ID | 11060 |
Protein Families | Druggable Genome |
Protein Pathways | Ubiquitin mediated proteolysis |
MW | 35.2 kDa |
Gene Summary | This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (3) lacks several 3' exons but has an alternate and much shorter 3' end, as compared to variant 1. The encoded isoform 3 is 3' truncated and thus lacks three WW domains and a HECT domain in the C-terminal region, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224229 | WWP2 (Myc-DDK-tagged)-Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3 |
CNY 3,656.00 |
|
RC224229L1 | Lenti ORF clone of Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224229L2 | Lenti ORF clone of Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC224229L3 | Lenti ORF clone of Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224229L4 | Lenti ORF clone of Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG224229 | WWP2 (tGFP-tagged) - Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3 |
CNY 4,370.00 |