TGIF (TGIF1) (NM_173207) Human Untagged Clone

CAT#: SC306805

TGIF1 (untagged)-Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 2



  "NM_173207" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TGIF1 mouse monoclonal antibody, clone OTI1B12 (formerly 1B12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPE4; TGIF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306805 representing NM_173207.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTTGCTCGGGCAAAAGTTGTGCATTGGCCCGATCAAGCCTGACTTCTAGCCAAGGTATTGTTGCA
GCATCTGGCAGTGAGACTGAGGATGAGGACAGCATGGACATTCCCTTGGACCTTTCTTCATCCGCTGGC
TCAGGCAAGAGAAGGAGAAGGGGCAACCTACCCAAGGAGTCTGTGCAGATTCTTCGGGATTGGCTGTAT
GAGCACCGTTACAATGCCTATCCTTCAGAGCAAGAAAAAGCGTTGCTGTCCCAGCAAACACACCTGTCT
ACGCTACAGGTCTGTAACTGGTTCATCAACGCCCGCCGCAGGCTCCTCCCTGACATGCTGAGAAAGGAT
GGCAAAGATCCAAATCAGTTCACAATTTCCCGCCGTGGGGCCAAGATTTCTGAAACGAGCTCTGTGGAG
TCCGTGATGGGCATCAAAAACTTCATGCCAGCTCTAGAGGAGACCCCATTTCATTCCTGTACAGCTGGG
CCAAACCCAACCCTAGGGAGGCCACTGTCTCCTAAGCCGTCATCCCCGGGATCAGTTTTGGCTCGTCCA
TCAGTGATCTGCCATACCACTGTGACTGCATTGAAAGATGTCCCTTTCTCTCTCTGCCAGTCGGTCGGT
GTGGGACAAAACACAGATATACAGCAGATAGCGGCCAAAAACTTCACAGACACCTCTCTCATGTACCCA
GAGGACACTTGTAAATCTGGACCAAGTACGAATACACAGAGTGGTCTTTTCAACACTCCTCCCCCTACT
CCACCGGACCTCAACCAGGACTTCAGTGGATTTCAGCTTCTAGTGGATGTTGCACTCAAACGGGCTGCA
GAGATGGAGCTTCAGGCAAAACTTACAGCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_173207
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173207.2
RefSeq Size 1498 bp
RefSeq ORF 861 bp
Locus ID 7050
UniProt ID Q15583
Protein Families Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
MW 31.1 kDa
Gene Summary The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) has an alternate 5' terminal exon, which results in a different 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...